Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of SlHDA4 gene in cultivation of apical dominance enhanced tomato germplasm

An apical dominance and enhanced technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of decreased IAA content and inability to completely suppress side buds, etc., to increase auxin content, enhance apical dominance, and reduce the workload of pruning Effect

Active Publication Date: 2022-03-08
ZHEJIANG UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Morris et al. found in the pea topping experiment that the IAA content in the stem of the topping plant decreased significantly, accompanied by the occurrence of lateral buds, but the addition of auxin IAA could not completely inhibit the occurrence of lateral buds (Morris D A. Transport of exogenous auxin in two-branched dwarf peaseedlings(Pisum sativum L.).Planta,1977,136(1):91-96.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of SlHDA4 gene in cultivation of apical dominance enhanced tomato germplasm
  • Application of SlHDA4 gene in cultivation of apical dominance enhanced tomato germplasm
  • Application of SlHDA4 gene in cultivation of apical dominance enhanced tomato germplasm

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1 SlHDA4 gene transgenic plant acquisition

[0037] One, the construction of SlHDA4 gene overexpression vector

[0038] In order to promote the innovation of tomato apical dominance-enhanced germplasm and explore the function of histone deacetylases in tomato side branching, the SlHDA4 gene was cloned from the tomato genome database, and its code is Solyc11g067020. According to the SlHDA4 coding region sequence, the multiple cloning site of the overexpression vector pFGC1008-HA and its surrounding sequences, select restriction enzyme sites (AscI and KpnI) and design homology arms, and use the software CE DesignV1.03 to generate specific primers The sequences of SlHDA4-F (ttacaattaccatggggcgcgccATGAGGTCCAAGGACAAAATCTCC) and SlHDA4-R (aacatcgtatgggtaggtaccGGCATCATCAGTGTGGTTATCG) are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0039] Use KOD high-fidelity enzyme PCR to amplify the SlHDA4 fragment, purify and recover the PCR product, perform double enz...

Embodiment 2

[0042] Example 2 Acquisition of SlHDA4 Gene Knockout Plants

[0043] 1. Construction of SlHDA4 Gene CRISPR / Cas9 Gene Knockout Vector

[0044] To explore the effect of SlHDA4 deletion on tomato collateral formation, we designed the sgRNA sequence of SlHDA4, constructed pCAMBIA1301-U6-26-sgRNA-SlHDA4-35S-cas9SK vector, and knocked out SlHDA4 by CRISPR / Cas9 technology for research.

[0045] Design the target sequence of the SlHDA4 gene through the website (https: / / www.genome.arizona.edu / crispr / CRISPRsearch.html) CRISPR-P, and add BbsI restriction endonuclease sticky ends (aaaatctcctacttctacga) at both ends, the specific sequence As shown in SEQ ID NO.5. Anneal the synthetic single-stranded sgRNA sequence to form double-stranded sgRNA. The CRISPR vector U6-26-sgRNA-35S-cas9SK was single-digested with BbsI restriction endonuclease. use T 4 Ligase connects the sgRNA to the linearized U6-26-sgRNA-35S-cas9SK vector, sends it to the sequencing company for sequencing, and extracts t...

Embodiment 3

[0048] Example 3 qRT-PCR analysis of the expression of SlHDA4 gene in different tissues and organs of tomato

[0049] Using qRT-PCR to study the expression pattern of SlHDA4 gene, the specific method of qRT-PCR is as follows:

[0050] use 480II fluorescent quantitative PCR instrument (Roche, Swiss) was used for detection. For details of the reaction system, refer to the instruction manual of 2×SYBR Green Supermix (Vazyme). The specific primers of SlHDA4 gene are (RT-SlHDA4-F: 5'-TAAATTGGGCTGGTGGCTTG-3'; RT-SlHDA4-R: 5'-CCCGCGGATGATACTTCAGA-3'), referring to the method of Livak and Schmittgen (Livak, K.J.and Schmittgen, T.D.Analysis of Relative GeneExpression Data Using Real-Time Quantitative PCR and the 2ΔΔC TMethod.Methods, 2001,25(4):402-408.), using 2 -ΔΔCt Calculation of relative expression levels of genes.

[0051] The results showed that SlHDA4 was expressed in different tissues, with the highest expression in leaves and relatively low expression in roots and stems ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of an SlHDA4 gene in cultivation of apical dominance enhanced tomato germplasm. The nucleotide sequence of the SlHDA4 gene is shown as SEQ ID NO. 1. A tomato SlHDA4 overexpression plant is constructed through a molecular means and a tissue culture technology, the expression level of the SlHDA4 gene is improved, and it is found that the overexpression SlHDA4 gene has significant influence on tomato plant type growth, that is, compared with a wild type, the plant height of the overexpression plant is significantly increased, the apical dominance is enhanced, and lateral bud growth is significantly inhibited. A series of physiological and biochemical analysis proves that compared with a wild type, the SlHDA4 overexpression material has the advantages that the expression of a terminal bud auxin synthetic gene is up-regulated, and the content of auxin is remarkably increased; meanwhile, the gene expression of the lateral bud generation inhibition factor SlBRC1 at the axilla is obviously increased.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of the SlHDA4 gene in cultivating apical dominance-enhanced tomato germplasm. Background technique [0002] A good plant type is conducive to reasonable and dense planting of crops, improving group photosynthesis, and promoting the transportation and transformation of photosynthetic products to product organs, thereby improving yield and quality. Tomato (Solanum lycopersicum L.) is an annual or perennial herbaceous plant belonging to the Solanaceae subgenus Solanum and is an important cultivated horticultural crop in my country. In recent years, the area of ​​protected gardening has increased rapidly, and the production of fresh tomatoes has gradually shifted from open field cultivation to protected cultivation. The improvement of the production environment of the facility makes the tomato side branches grow vigorously. It is necessary to manually adjust the tomato p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84C12N15/55A01H5/04A01H6/82
CPCC12N15/8294C12N15/8205C12N9/80C12Y305/01098
Inventor 夏晓剑宋雪薇齐振宇喻景权
Owner ZHEJIANG UNIV