Fermentation medium for Cap protein virus-like particles of porcine circovirus type 2
A type 2 virus, protein virus technology, applied in the direction of fermentation, virus, viral peptides, etc., can solve the problems of increased production cost, many miscellaneous proteins, low product yield, etc., to save production cost, improve production efficiency, and reduce purification. effect of difficulty
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Embodiment 1 Fermentation method of the present invention
[0041] 1. Strains
[0042] The bacterial strain is Escherichia coli (Chaperone competent cells pGro7 / BL21(DE3)), and the bacterial strain includes the expression vector pET28a carrying the target gene (gene expressing Cap protein), the sequence of the target gene is shown in SEQ ID NO.1, Located at the XhoI (restriction site) position of the vector.
[0043] SEQ ID NO.1:
[0044] atgacctacccgcgtcgtcgtttccgtcgtcgtcgtcaccgtccgcgttctcacctgggt 60
[0045] cagatcctgcgtcgtcgtccgtggctggttcacccgcgtcaccgttaccgttggcgtcgt 120
[0046] aaaaacggtatcttcaacacccgtctgtctcgtaccatcggttacaccgttaaaaaaacc 180
[0047] accgttcgtaccccgtcttggaacgttgacatgatgcgtttcaacatcaacgacttcctg 240
[0048] ccgccgggtggtggttctaacccgctgaccgttccgttcgaatactaccgtatccgtaaa 300
[0049] gttaaagttgaattctggccgtgctctccgatcacccagggtgaccgtggtgttggttct 360
[0050]accgctgttatcctggacgacaacttcgttaccaaagctaacgctctgacctacgacccg 420
[0051] tacgttaactactcttc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


