Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescence in-situ hybridization probe group for detecting AML1/ETO gene and application of fluorescence in-situ hybridization probe group

A fluorescence in situ hybridization and probe group technology, which is applied in DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problem of low probe specificity, long hybridization time, large probe fragments, etc. problems, to achieve improved resolution, high sensitivity, and high specificity

Pending Publication Date: 2022-04-19
WUHAN YZY MEDICAL SCI & TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional commercial FISH probes mainly use BAC clones as probes for hybridization detection after fluorescent molecular labeling. Then, the probes prepared by BAC clones have some non-repetitive sequences, and the specificity of the probes is not high. Cot1-DNA is needed for detection. Non-blocking closed, and the probe fragments are generally too large, the length is between 200-500bp, the hybridization efficiency is low, and the hybridization time is long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescence in-situ hybridization probe group for detecting AML1/ETO gene and application of fluorescence in-situ hybridization probe group
  • Fluorescence in-situ hybridization probe group for detecting AML1/ETO gene and application of fluorescence in-situ hybridization probe group
  • Fluorescence in-situ hybridization probe group for detecting AML1/ETO gene and application of fluorescence in-situ hybridization probe group

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] A method for preparing a fluorescent in situ hybridization probe set for detecting AML1 / ETO gene, specifically comprising the following steps:

[0022] S1, based on the sequences of AML1 and ETO genes, design a nucleotide sequence containing 45 bases in a 100kb region without repetitive sequences, set the Tm value of the probe at 50°C, and the GC content range of 40-60% , after discarding the sequence containing AAAA / TTTT / CCCC / GGGG, 2860 candidate probes were obtained, and after the whole gene (hg38) BLAST comparison analysis, a total of 2440 nucleotide sequences were finally obtained, as shown in Table 1 below ;

[0023] S2, add a 20bp tag sequence to the 5' end of each nucleotide sequence and a 20bp tag sequence to the 3' end to obtain a series of characteristic primers with tag sequences, wherein the 5' end tag sequence is : TAATACGACTCACTATAGGG (SEQ ID NO: 1), the 3' end tag sequence is: CCGCTGAGCAATAACTAGCA (SEQ ID NO: 2);

[0024] S3, using high-throughput chip ...

Embodiment 2

[0052] Embodiment 2 Normal people's peripheral lymphocyte droplet experiment

[0053] Materials: human peripheral blood lymphocyte culture medium, colchicine, hypotonic solution (0.4% KCl), fixative solution (methanol:acetic acid=3:1, volume ratio).

[0054] S1, cell culture and synchronization: take 0.4mL heparin anticoagulated whole blood (from the hospital) in human peripheral blood lymphocyte culture medium, mix well and culture in a constant temperature incubator at 37°C and 5% CO2 for 72h, and stop at For the first 4 hours, add colchicine to the medium to a final concentration (0.1 μg / mL) and continue culturing for 4 hours;

[0055] S2, collection and fixation: collect the medium, centrifuge at 500g for 5min, discard the supernatant, add 0.4% KCl hypotonic solution and incubate for 30min, then fix the cells with methanol-glacial acetic acid mixture, let stand at room temperature for 10min, centrifuge at 500g to pellet the cells , repeat the cell fixation step once, after ...

Embodiment 3

[0062] Referring to the method of Example 2 to detect slides containing 50 metaphase lymphocytes, the results are shown in Table 3 below. It can be seen that there are 99 FISH signal points of the AML1 gene probe, and the sensitivity reaches 99%. There are 99 FISH signal points for gene probes, and the sensitivity reaches 99%.

[0063] Table 3 Sensitivity test results of probes

[0064] probe type Metaphase lymphocytes (units) FISH signal points (pieces) sensitivity AML1 gene probe 50 99 99% ETO gene probe 50 99 99%

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of gene detection, in particular to a fluorescence in-situ hybridization probe set for detecting AML1 / ETO genes and application of the fluorescence in-situ hybridization probe set. The probe group is prepared from 2440 nucleotide sequences shown in the specification table 1. According to the invention, in a target region of AML1 and ETO genes, a single-chain fragment which is completely complementary to the target region and has a length of 45bp is directly constructed as a candidate probe, and then each sequence is subjected to batch BLAST comparison, so that high specificity of each hybridized probe sequence is ensured; meanwhile, the targeting of a target area is accurately controlled, the size limitation of the probe is broken through, and the resolution of the probe is improved; in the preparation process, a PCR (Polymerase Chain Reaction) doping method is adopted to ensure that the product contains more fluorophores. The probe group is used for detecting the AML1 / ETO gene rearrangement state, the cost is low, FISH hybridization of a bone marrow sample can be completed within about 30 minutes, the sensitivity is high, the specificity is strong, the hybridization background is clean, and the signal-to-noise ratio is low.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a fluorescent in situ hybridization probe set for detecting AML1 / ETO gene and its application. Background technique [0002] Leukemia is a malignant clonal disease originating from hematopoietic stem cells. Clonal leukemia cells accumulate in the bone marrow and other hematopoietic tissues due to mechanisms such as uncontrolled proliferation, impaired differentiation, and blocked apoptosis, thereby inhibiting the normal hematopoietic function of the bone marrow and infiltrating other tissues and organs. . The AML1 / ETO fusion gene is a common cytogenetic abnormality in patients with acute myeloid leukemia (AML), with an incidence of about 10% in AML patients and up to 40% in M2 types, mainly in the M2b subtype , the positive rate is as high as 90%, and the M2b subtype has the characteristics of good treatment response, high complete remission rate, and long remission perio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6841C12Q1/6827C12N15/11
CPCC12Q1/6841C12Q1/6827C12Q2531/113C12Q2563/107
Inventor 祝丹平魏亮董祥马云飞吴文雅
Owner WUHAN YZY MEDICAL SCI & TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More