Primer probe group and kit for detecting FPV by RAA fluorescence method

A technology of primer probe and fluorescence method, which is applied in the direction of DNA/RNA fragments, microorganisms, recombinant DNA technology, etc., can solve the problems of complex operation of personnel and equipment, complex design of primer probes, and high technical false positives, so as to avoid environmental pollution , Reliable detection results and high sensitivity

Pending Publication Date: 2022-05-10
GUANGXI VETERINARY RES INST
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PCR and Q-PCR technology have good repeatability, high sensitivity, strong specificity, and high detection rate, but the operation is complicated, there are high requirements for personnel and equipment, and the detection time is long; LAMP technology is a relatively new genetic diagnosis The principle of this technology is to design 4 specific primers for 6 regions of the target gene, and use a DNA polymerase with strand displacement activity to automatically cycle through the strand displacement DNA synthesis process at a constant temperature of 65°C for about 60 minutes. Amplification of target DNA, but the technology has high false positives, complex design of primers and probes, and difficult design

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer probe group and kit for detecting FPV by RAA fluorescence method
  • Primer probe group and kit for detecting FPV by RAA fluorescence method
  • Primer probe group and kit for detecting FPV by RAA fluorescence method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] The present invention is used to detect the fluorescent RAA primer of feline parvovirus, probe design is as follows:

[0023] Design specific primers and fluorescent probes based on the specific conserved region of feline parvovirus: The research team designed 3 pairs of primers, as shown in Table 1:

[0024] Table 1 Primer related information

[0025] Primer name Primer sequence (5'-3') degenerate primer FPV-RAA-F1 AAATTCTGTGCCAGTACACTTACTAAGAACAGG FPV-RAA-F2 TYGCTACAGGAACATTTTTTTTTGATTGYAAAC Y=C / T FPV-RAA-F3 CTTACCACCATTTYTAAATTCTTTRCCTCAATC R=A / G FPV-RAA-R1 GTGCTATATATGTAAATCTCTCKGGTGTTTCTC K=G / T FPV-RAA-R2 CCCTTGTGTAGAYGCTTCAAAGAATAATATGG Y=C / T FPV-RAA-R3 AGTTACACCACGTCTTTTTATCTTGTTGARCTCC R=A / G

[0026] By combining the above primers in pairs, 9 pairs of primers were obtained, namely: FPV-RAA-F1 / R1, FPV-RAA-F2 / R2, FPV-RAA-F3 / R3, FPV-RAA-F1 / R2, FPV- RAA-F1 / R3, FPV-RAA-F2 / R1, FPV-RAA-F2 / R3, FPV-...

Embodiment 2

[0038] The present embodiment adopts the fluorescent RAA method that the primer of embodiment 1 detects feline parvovirus, specifically as follows:

[0039] (1) Isothermal fluorescent RAA reaction

[0040] 1. Sample DNA extraction: collect anal swabs of sick cats or tissue samples of dead cats, use AXYGEN virus DNA / RNA small amount extraction kit, extract DNA according to the kit instructions, and use the product directly for RAA reaction or place in- Store at 80°C for later use.

[0041] 2. Use FPV-RAA-F2, reverse primer FPV-RAA-R2, fluorescent probe FPV-RAA-P, and RAA dry powder tube (Nanning Zhuangbo Biotechnology Co., Ltd.), and use the prepared DNA sample as a template for RAA Amplification, reaction system: Add 25 μL of A Buffer to RAA dry powder tube; 2 μL each of FPV-RAA-F and FPV-RAA-R (10 μmol / L); 0.6 μL of probe FPV-RAA-P (10 μmol / L); DNA Template 2 μL; make up ddH 2 O to 47.5μL, mix well and centrifuge briefly, then add 2.5μL BBuffer and mix well. The recombinant...

Embodiment 3

[0053] Clinical Sample Testing Test

[0054] 12 feline anal swabs suspected of being infected with feline parvovirus collected from different pet hospitals in Nanning were detected and verified according to the fluorescent RAA detection method, PCR method and fluorescent quantitative PCR method of the present invention. The results showed that among the 12 samples detected by the fluorescent PCR method and the fluorescent RAA method, 5 samples had obvious amplification curves, which were positive, and 7 samples had no obvious amplification curves, which were negative. The results of the two methods The coincidence rate was 100%. Among the samples detected by PCR, 3 samples were positive and 9 samples were negative, and among the 5 samples detected positive by fluorescent RAA method, the ordinary PCR test was negative.

[0055] In summary, the primer-probe set of the present application has the advantages of high sensitivity, wide detection range, strong specificity, and outsta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biology, and particularly relates to a primer probe set and a kit for detecting FPV through an RAA fluorescence method.The primer probe set can detect more FPV genotypes after degeneracy design, compared with other primer probe sets, it is found that the primer probe set has the advantages of being high in sensitivity and better in detection effect, and meanwhile the primer probe set can be used for detecting the FPV genotypes. The invention also prepares a corresponding RAA kit and establishes a corresponding RAA detection method, tests show that the kit can be carried out under a constant temperature condition (37-42 DEG C), can realize rapid and qualitative detection of the feline parvovirus within 5-30 min, has the characteristics of convenience in operation, strong specificity, high sensitivity and good repeatability, and can completely meet the requirements of rapid diagnosis of the feline parvovirus, rapid diagnosis of the feline parvovirus, rapid diagnosis of the feline parvovirus, rapid diagnosis of the feline parvovirus, rapid diagnosis of the feline parvovirus, rapid diagnosis of the feline parvovirus and rapid diagnosis of the feline parvovirus. The kit is suitable for clinical rapid detection and has a wide application prospect.

Description

【Technical field】 [0001] The invention relates to the field of biotechnology, in particular to a primer probe group and a kit for detecting FPV by RAA fluorescence method. 【Background technique】 [0002] Feline distemper, also known as feline panleukopenia, feline infectious enteritis, etc., is an acute, highly contagious and fatal infectious disease of cats caused by feline parvovirus (FPV). Clinically, it is characterized by sudden high fever, vomiting, diarrhea and severe leukopenia. It is the most common infectious disease in domestic cats. FPV can be infected through direct or indirect contact. The infected animals excrete toxins through feces, urine, vomit, saliva and other excretions and secretions, polluting the environment, utensils, feed, etc., causing direct and indirect infection, often showing endemic epidemics. The case fatality rate is generally 60% to 70%, up to more than 90% (the death rate of young animals can reach 100%). FPV is often co-infected with ot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6844C12Q2521/507C12Q2531/119C12Q2563/107
Inventor 吴健敏刘金凤覃绍敏宋瑞鹏马玲陈凤莲林俊秦树英韦珏许力士韦珊珊杨磊
Owner GUANGXI VETERINARY RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap