Leucine dehydrogenase mutant and application thereof in synthesis of (S)-2-chlorophenylglycine

A technology of leucine dehydrogenase and o-chlorophenylglycine, which is applied to leucine dehydrogenase mutant and its application field in the synthesis of (S)-o-chlorophenylglycine, and can solve the problem of low substrate feeding amount , the problem of low asymmetric amination activity of o-chlorobenzoylformic acid, etc., to achieve the effect of high catalytic rate, high product e.e value and mild reaction conditions

Active Publication Date: 2022-05-17
ZHEJIANG UNIV OF TECH
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The object of the present invention is to provide a stereoselective leucine dehydrogenase mutant for the problems of low asymmetric amination activity of the existing leucine dehydrogenase to o-chlorobenzoylformic acid and low substrate dosage And the application of using the leucine dehydrogenase mutant gene recombinant bacteria to transform o-chlorobenzoylformic acid into (S)-o-chlorophenylglycine, the activity of the catalyst under the condition of pH9.0 is higher than that of wild-type leucine dehydrogenation The activity of enzyme EsLeuDH under the condition of pH7.0 has been improved 32 times, and the substrate feeding amount has been improved to 500mM, and the obtained mutant is also applied to the construction of chemical-enzymatic synthesis (S)-o-chlorophenylglycine route, as ( The chiral intermediate (S)-o-chlorophenylglycine of S)-clopidogrel provides a new synthetic method and a new biocatalyst

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Leucine dehydrogenase mutant and application thereof in synthesis of (S)-2-chlorophenylglycine
  • Leucine dehydrogenase mutant and application thereof in synthesis of (S)-2-chlorophenylglycine
  • Leucine dehydrogenase mutant and application thereof in synthesis of (S)-2-chlorophenylglycine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Construction and screening of leucine dehydrogenase random mutation library

[0029] The vector pET28a(+)-esleudh (leucine dehydrogenase esleudh amino acid sequence shown in SEQ ID NO.2 in the starting strain E.coli BL21(DE3) / pET28a(+)-esleudh, encoding gene nucleotide sequence As shown in SEQ ID NO.1) as a template, using epPCR-F and epPCR-R in Table 1 as primers, using an error-prone PCR kit (purchased from Tianenze Company, ready-to-use error-prone PCR kit) to construct random mutations library.

[0030] EsLeuDH nucleotide sequence:

[0031] atggtggaaacgaacgttgaggcgcgcttctcgattttcgagacgatggcgatggaagactacgaacaggtggttttttgccatgacaaagtgagcgggctgaaagcaattattgcgattcatgataccaccctgggtccggcactgggtggcctgagaatgtggaattatgcaagcgatgaagaagcattaattgatgcattacgcctggcaaaaggtatgacctacaaaaacgcagcagcaggcctgaatttaggtggtggtaaagcggttataatcggggacgccaaaacccagaaaagcgaagcactgtttagagcatttggtcgttacgttcagagcctgaacggaagatatattacagcagaggatgttaatacaacagttgcagatatggattatatccatatggaaacagatt...

Embodiment 2

[0039] Example 2: Inducible expression of wild-type leucine dehydrogenase, mutants and glucose dehydrogenase

[0040] Glucose dehydrogenase genetically engineered bacteria: according to the glucose dehydrogenase gene (Genbank accession number: 1RWB_A) from Bacillus megaterium (Bacillus megaterium) IWG3, artificially synthesized glucose dehydrogenase bmgdh gene (nucleotide sequence such as SEQ ID NO. 3, the amino acid sequence of the encoded protein (as shown in SEQ ID NO.4) was inserted between the Nco I and Xho I restriction sites of pET28b (+) to construct a recombinant expression vector, and this expression vector was transferred into E. coli BL21(DE3), E. coli BL21(DE3) / pET28b(+)-bmgdh was produced.

[0041] bmgdh nucleotide sequence:

[0042] ATGTACAAGGACCTTGAGGGAAAGGTCGTCGTCATTACTGGATCTTCTACTGGACTGGGAAAGTCTATGGCTATTCGATTCGCTACTGAGAAGGCTAAGGTCGTCGTGAACTACCGATCTAAGGAGGACGAGGCTAACTCTGTCCTTGAGGAGATTAAGAAGGTCGGAGGAGAGGCTATTGCTGTCAAGGGTGACGTCACTGTCGAGTCTGACGTCATTAACCTGGTCCAGT...

Embodiment 3

[0045] Embodiment 3: Enzyme activity assay of wild-type leucine dehydrogenase

[0046] 1. Determination of enzyme activity

[0047] The starting strain E.coli BL21 (DE3) / pET28a (+)-esleudh wet thallus and E.coli BL21 (DE3) / pET28b (+)-bmgdh wet thallus with dry weight ratio 2: 1(w / w) mixed into the starting mixed cells.

[0048] Enzyme activity unit (U) is defined as: under the conditions of 40°C and pH 9.0, the amount of enzyme required to produce 1 micromole of (S)-o-chlorophenylglycine per minute is defined as an enzyme activity unit, U. Specific enzyme activity is defined as the number of activity units per mg of enzyme protein, U / mg.

[0049] Enzyme activity assay method: use the starting mixed bacteria as a catalyst, o-chlorobenzoylformic acid as a substrate, glucose as an auxiliary substrate, and add a small amount of exogenous NAD + , with pH 9.0, 100mM Tris-HCl buffer as the reaction medium, a coenzyme circulation system was established. The reaction system was sel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a leucine dehydrogenase mutant and application of the leucine dehydrogenase mutant in synthesis of (S)-2-chlorophenylglycine. The leucine dehydrogenase mutant is obtained by performing site-specific saturation mutation on the 362th site of an amino acid sequence shown in SEQ ID NO.2. The invention further discloses a preparation method of the leucine dehydrogenase mutant. The activity of the constructed leucine dehydrogenase mutant EsLeuDH-F362L is increased by 32 times compared with that of wild leucine dehydrogenase, the feeding amount of the substrate o-chlorobenzoyl formic acid of the mutant EsLeuDH-F362L can reach 500 mM, the product concentration is gradually increased along with time, the reaction can be completed within 4.0 h, the substrate conversion rate is larger than 99%, and the e.e value of the product is always kept to be 99.5% or above. Therefore, the bright group acid dehydrogenase mutant EsLeuDH-F362L has an industrial application prospect.

Description

(1) Technical field [0001] The present invention relates to a mutant of leucine dehydrogenase EsLeuDH derived from Exiguobacterium siberia, a recombinant bacterium for developing a mutant of leucine dehydrogenase and enzyme in clopidogrel chiral intermediate (S)-o-chloro Applications in the catalytic synthesis of phenylglycine. (2) Background technology [0002] (S)-Clopidogrel, the chemical name is (S)-(+)-2-(2-chloro)-2(4,5,6,7-tetrahydrothiophene[3,2-c ]pyridine-5) methyl acetate is a thienopyridine drug developed in 1986 by the French Sanofi (Sanofi) company. In 1998, the US FDA approved the listing of clopidogrel, and its trade name was "Plavix". At present, clopidogrel is currently one of the most sold drugs in the world, with annual sales of up to 6.4 billion US dollars. [0003] (S)-o-chlorophenylglycine, also known as (S)-2-amino-(2-chlorophenyl)acetic acid, is a non-natural chiral amino acid with biological activity. One of its most important uses is to use for...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/06C12P13/04C12N15/70C12N1/21C12R1/19
CPCC12N9/0016C12Y104/01009C12P13/04C12N15/70
Inventor 王亚军谢为邦程峰郑裕国
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap