Expression method of recombinant duck type 3 adenovirus fiber-2 gene
A fiber-2 and expression method technology, which is applied in the preparation methods of peptides, viruses, viral peptides, etc., can solve the problems of unstable expression strains, easy loss of plasmids, low expression levels, etc. Stable, high protein yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Preparation of recombinant duck adenovirus type 3 fiber-2 gene
[0039] The disease materials used in this study came from Muscovy duck farms in Baoding City, Hebei Province. Diseased ducks with suspected characteristics of duck adenovirus type 3 infectious disease were selected as disease materials. After the genome extraction of the disease materials, primers were designed for PCR detection and sequencing. After analysis, the fiber 2 gene sequence was obtained, as shown in SEQ NO 2, and then Beijing Qingke Biotechnology Co., Ltd. carried out sequence optimization according to the preferred codons of Kluyveromyces marxianus, and the optimized gene sequence was shown in SEQ NO 1 .
Embodiment 2
[0040] Example 2. Expression of recombinant duck adenovirus fiber-2 gene in Kluyveromyces marxianus
[0041] 1. The preparation method of recombinant plasmid in Kluyveromyces marxianus expression system, comprising the following steps:
[0042] ①Strain activation: Pick a single colony of Kluyveromyces marxianus TOP1 and inoculate it into 3 mL YPD liquid medium, cultivate overnight at 30°C and 200 rpm, and measure the OD value of 12-15.
[0043] ②Yeast transformation: Take 1 mL of the overnight cultured bacterial solution into a 1.5 mL EP tube, centrifuge at 8000 rpm for 1 min, discard the supernatant, add 1 mL of sterile water to wash, centrifuge at 8000 rpm for 1 min, and discard the supernatant; add 1 mL of 1×LiAc / TE Wash, centrifuge at 8000 rpm for 1 min, discard the supernatant, wash twice, and prepare 3 tubes of bacterial cells according to this washing method;
[0044]The two vectors, pUKD-N115 and pUKD-N112, were added to 4 tubes, respectively, with the unoptimized typ...
Embodiment 3
[0064] Example 3 Evaluation of Vaccine Effect
[0065] 50 SPF Muscovy ducks of 2 days old were selected and divided into 5 groups. The purified protein obtained in Example 2 was diluted doublingly, and Marcol-52 white was prepared according to the titers of 1:32, 1:64 and 1:128. The vaccine was formulated with oil as an adjuvant. Each group was injected with 10 Muscovy ducks, each with 0.3 ml subcutaneously. The challenge control group and the negative control group were not injected. After 21 days of immunization, the experimental group and the challenge control group were each injected with duck type 3 subcutaneously. Adenovirus liver grinding supernatant was 1 mL, and 7 days later, anal swabs were taken, mixed with 1 mL of PBS and centrifuged, and the detoxification was detected by PCR. The forward primer of PCR reaction is 22K-F (5'ACCCAAAAGCAAGTGGACGC 3'), and the reverse primer is 22K-R (5'CGGAATCACCACCTTCCTCG3'). The system is as follows:
[0066] PCR reaction system ...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com