Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression method of recombinant duck type 3 adenovirus fiber-2 gene

A fiber-2 and expression method technology, which is applied in the preparation methods of peptides, viruses, viral peptides, etc., can solve the problems of unstable expression strains, easy loss of plasmids, low expression levels, etc. Stable, high protein yield

Pending Publication Date: 2022-05-27
TIANJIN RINGPU BIO TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is also to overcome the technical defects of traditional expression methods such as low expression level, unstable expression strains, easy loss of plasmids, and excessive glycosylation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression method of recombinant duck type 3 adenovirus fiber-2 gene
  • Expression method of recombinant duck type 3 adenovirus fiber-2 gene
  • Expression method of recombinant duck type 3 adenovirus fiber-2 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Preparation of recombinant duck adenovirus type 3 fiber-2 gene

[0039] The disease materials used in this study came from Muscovy duck farms in Baoding City, Hebei Province. Diseased ducks with suspected characteristics of duck adenovirus type 3 infectious disease were selected as disease materials. After the genome extraction of the disease materials, primers were designed for PCR detection and sequencing. After analysis, the fiber 2 gene sequence was obtained, as shown in SEQ NO 2, and then Beijing Qingke Biotechnology Co., Ltd. carried out sequence optimization according to the preferred codons of Kluyveromyces marxianus, and the optimized gene sequence was shown in SEQ NO 1 .

Embodiment 2

[0040] Example 2. Expression of recombinant duck adenovirus fiber-2 gene in Kluyveromyces marxianus

[0041] 1. The preparation method of recombinant plasmid in Kluyveromyces marxianus expression system, comprising the following steps:

[0042] ①Strain activation: Pick a single colony of Kluyveromyces marxianus TOP1 and inoculate it into 3 mL YPD liquid medium, cultivate overnight at 30°C and 200 rpm, and measure the OD value of 12-15.

[0043] ②Yeast transformation: Take 1 mL of the overnight cultured bacterial solution into a 1.5 mL EP tube, centrifuge at 8000 rpm for 1 min, discard the supernatant, add 1 mL of sterile water to wash, centrifuge at 8000 rpm for 1 min, and discard the supernatant; add 1 mL of 1×LiAc / TE Wash, centrifuge at 8000 rpm for 1 min, discard the supernatant, wash twice, and prepare 3 tubes of bacterial cells according to this washing method;

[0044]The two vectors, pUKD-N115 and pUKD-N112, were added to 4 tubes, respectively, with the unoptimized typ...

Embodiment 3

[0064] Example 3 Evaluation of Vaccine Effect

[0065] 50 SPF Muscovy ducks of 2 days old were selected and divided into 5 groups. The purified protein obtained in Example 2 was diluted doublingly, and Marcol-52 white was prepared according to the titers of 1:32, 1:64 and 1:128. The vaccine was formulated with oil as an adjuvant. Each group was injected with 10 Muscovy ducks, each with 0.3 ml subcutaneously. The challenge control group and the negative control group were not injected. After 21 days of immunization, the experimental group and the challenge control group were each injected with duck type 3 subcutaneously. Adenovirus liver grinding supernatant was 1 mL, and 7 days later, anal swabs were taken, mixed with 1 mL of PBS and centrifuged, and the detoxification was detected by PCR. The forward primer of PCR reaction is 22K-F (5'ACCCAAAAGCAAGTGGACGC 3'), and the reverse primer is 22K-R (5'CGGAATCACCACCTTCCTCG3'). The system is as follows:

[0066] PCR reaction system ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention provides an expression method of a recombinant duck type 3 adenovirus fiber-2 gene in a kluyveromyces marxianus expression system, which comprises the following steps: firstly, connecting the optimized duck type 3 adenovirus fiber-2 gene into an expression plasmid pUKD-N115, and then converting a connection product into uracil deletion type kluyveromyces marxianus TOP1 for expression, and finally, the recombinant saccharomycetes for expressing the duck type 3 adenovirus fiber-2 protein is obtained. According to the Kluyveromyces marxianus vaccine, the high-efficiency expression of the recombinant plasmid in the Kluyveromyces marxianus is successfully realized, and the vaccine containing the expression product has a certain protection effect on adenovirus infection experiments of Muscovy ducks.

Description

technical field [0001] The invention belongs to the field of veterinary biological products, in particular to a method for expressing the fiber-2 gene of duck type 3 adenovirus. Background technique [0002] Adenovirus is a non-encapsulated linear double-stranded DNA virus with a diameter of 70-90 nm and regular dodecahedral symmetry. The capsid is composed of 252 capsomers arranged in an icosahedron, and each capsid is 7-9 nm in diameter. Both ends have inverted repeats of about 100 bp in length. Adenoviruses are named because of their tendency to infect epithelial cells. Since the first strain of adenovirus (adenovirus, ADV) was isolated in the 1950s, adenoviruses have been isolated from many vertebrates one after another. According to the different host ranges, adenoviruses are currently divided into five genera, mammalian ADV (Mastadenovirus), avian ADV (Aviadenovirus), AT-rich ADV (Atadenovirus), sialidase ADV (Siadenovirus) American white sturgeon Adenovirus (Ichta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/34C12N15/81C12N15/66C07K14/075C07K1/34A61K39/235A61P31/20
CPCC07K14/005C12N15/815C12N15/66A61K39/12A61P31/20C12N2800/22C12N2800/102C12N2710/10022C12N2710/10034Y02A50/30
Inventor 李守军段进坤史琪雯车艳杰陈爽杨燚张桂红李睿刘海霞
Owner TIANJIN RINGPU BIO TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com