Whole-cell biosensor for detecting p-nitrophenol and detection method

A biosensor, p-nitrophenol technology, applied in the direction of microorganism-based methods, biochemical equipment and methods, botany equipment and methods, etc., can solve the problem that the detection method cannot meet the requirements of rapid, high-throughput and accurate detection of nitrophenol and other issues to achieve the effect of high-throughput detection

Pending Publication Date: 2022-07-22
SHENZHEN UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In view of the above-mentioned deficiencies in the prior art, the object of the present invention is to provide a whole-cell biosensor and detection method for detecting p-nitrophenol, aiming at solving the problem that the existing microbial whole-cell biosensor detection method cannot meet the requirements for p-nitrophenol. Problems with Rapid, High-Throughput, and Accurate Detection of Phenols

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Whole-cell biosensor for detecting p-nitrophenol and detection method
  • Whole-cell biosensor for detecting p-nitrophenol and detection method
  • Whole-cell biosensor for detecting p-nitrophenol and detection method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0068] The embodiment of the present invention also provides a preparation method of a whole-cell biosensor for detecting p-nitrophenol as described above in the embodiment of the present invention, wherein the method includes the steps:

[0069] S11, using primer polymerase chain reaction, clone the gene sequence of pPNP gene fragment from pET22b-YFP plasmid (its nucleotide sequence is shown as SEQ ID NO: 3), from pMV_pobRO plasmid (its nucleotide sequence is shown as SEQ ID NO: 3) NO: 4) clone the gene sequence of pobRO-m reporter gene fragment, clone the gene sequence of mrfp reporter gene fragment from pUC19_mrfp plasmid (its nucleotide sequence is shown as SEQ ID NO: 5);

[0070] S12, using the mixture of the obtained pobRO-m reporter gene fragment and the amplified product of the mrfp reporter gene fragment as a template, using primer polymerase chain reaction to obtain the pobRO-m-mrfp gene;

[0071] S13, connecting the pobRO-m-mrfp gene to the pClone007 backbone to obt...

Embodiment 1

[0144] Preparation of whole-cell biosensor E.coli BL21 / pPNP-mrfp:

[0145] (1) The gene sequence of the pPNP gene fragment (4677bp) of the backbone structure of the pET22b plasmid was cloned from the pET22b-YFP plasmid by using primer polymerase chain reaction (PCR), and the annealing temperature was 53°C;

[0146] Primers used to amplify the pPNP gene fragment:

[0147] Forward primer sequence (pPNPF): GAGATCCGGGCTGCTAACAAAGC;

[0148] Reverse primer sequence (pPNPR): GGATCCGCGACCCATTTGC;

[0149] (2) using primer polymerase chain reaction (PCR), clone the gene sequence of pobRO-m reporter gene fragment (842bp) from pMV_pobRO plasmid, and the annealing temperature is 60 ℃;

[0150] Primers used to amplify the pobRO-m reporter gene fragment:

[0151] Forward primer sequence (pobR-mF): TTATACCAGATTGCGCAGTTTCGTTG;

[0152] Reverse primer sequence (pobR-mR): AAACCATTTTGGATTTGAATGTTATGATGGAACAACA

[0153] CCATCAGTATTTGG;

[0154] (3) using primer polymerase chain reaction (P...

Embodiment 2

[0177] Preparation of whole-cell biosensor E.coli BL21 / pPNP-amilCP:

[0178] (1) The gene sequence of the pPNP gene fragment (4677bp) was cloned from the pET22b-YFP plasmid by using primer polymerase chain reaction, and the annealing temperature was 53°C;

[0179]Primers used to amplify the pPNP gene fragment:

[0180] Forward primer sequence (pPNPF): GAGATCCGGGCTGCTAACAAAGC;

[0181] Reverse primer sequence (pPNPR): GGATCCGCGACCCATTTGC;

[0182] (2) using primer polymerase chain reaction, clone the gene sequence of pobRO-a reporter gene fragment (949bp) from pMV_pobRO plasmid, annealing temperature is 55 ℃;

[0183] Primers used to amplify the pobRO-a reporter gene fragment:

[0184] Forward primer sequence (pobR-aF): TTATACCAGATTGCGCAGTTTCGTTG;

[0185] Reverse primer sequence (pobR-aR): ATGTATATCTCCTTGCTATTTTCTATTTT;

[0186] (3) using primer polymerase chain reaction, clone the gene sequence of amilCP reporter gene fragment (698bp) from pUC19_amilCP plasmid, annealing...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a whole-cell biosensor for detecting p-nitrophenol and a detection method, the whole-cell biosensor for detecting p-nitrophenol comprises a host cell and a pPNP-mrfp plasmid or a pPNP-ami1CP plasmid located in the host cell, the nucleotide sequence of the pPNP-mrfp plasmid is shown as SEQ ID NO: 1, the nucleotide sequence of the pPNP-ami1CP plasmid is shown as SEQ ID NO: 2, and the nucleotide sequence of the pPNP-mrfp plasmid or the nucleotide sequence of the pPNP-ami1CP plasmid is shown as SEQ ID NO: 3. The nucleotide sequence of the pPNP-amilCP plasmid is as shown in SEQ ID NO: 2, and the physical map of the pPNP-mrfp plasmid and the physical map of the pPNP-amilCP plasmid are as shown in figure 1. When the whole-cell biosensor is used for detecting extracted paranitrophenol in soil, the combination of paranitrophenol and repressor protein pobR eliminates the combination of pobR and manipulating gene locus (pobO), reverse fluorescent protein or chromoprotein genes are transcribed to generate fluorescent protein or chromoprotein, and by detecting the fluorescence intensity value or absorbance value, the content of paranitrophenol in the soil can be detected. The rapid and high-throughput detection of the extracted p-nitrophenol in the soil is realized.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a whole-cell biosensor and a detection method for detecting p-nitrophenol. Background technique [0002] p-Nitrophenol is a class of aromatic hydrocarbon compounds widely used in chemical raw materials and pharmaceutical intermediates. It has a long half-life in the natural environment and poses a threat to the ecological environment. It is identified as an environmental endocrine disruptor. At present, various detection methods play an important role in the prevention and control of pollution risks of p-nitrophenol, such as high performance liquid chromatography (HPLC) and new rapid detection methods (sensors of new nanomaterials). Existing methods cannot directly and timely reflect the comprehensive effects (bioavailability) of various toxic substances on organisms in complex environmental media. Whole-cell biosensors, as a microorganism-mediated and environmental...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12N15/66C12N15/65C12N15/64C12N15/54C12Q1/02C12R1/19
CPCC12N9/1077C12N15/70C12N15/65C12Q1/025C12Y204/02001G01N2333/245Y02A50/30
Inventor李猛马钊
OwnerSHENZHEN UNIV