Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cathepsin B gene of Helicoverpa armigera and its cloning, recombining and expressing technique

A technique for cathepsin and cotton bollworm, which is applied in the fields of molecular biology and biology, and can solve the problem that the function of protease needs to be further studied.

Inactive Publication Date: 2004-08-18
SHANDONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Other functions of this protease need further study

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Embodiment 1: a kind of cloned cotton bollworm cathepsin BcDNA gene has the following sequence:

[0082] (1) Information on SEQ ID NO 1

[0083] (a) Sequence features:

[0084] * Length: 1310 bp

[0085] *Type: nucleic acid

[0086] * Chain type: double chain

[0087] *Topology: Linear

[0088] (b) Molecular type: cDNA

[0089] (c) Assumption: No

[0090] (d) Antisense: no

[0091] (e) Original source: Cotton bollworm (Helicoverpa armigera)

[0092] (f) Sequence description: SEQ ID NO.1

[0093] GAAGACCACATCAGGGCTGAGTTATTTTAAGAACGGCCCAGTTGAAGGTGCAGCTCAGTCG-60

[0094] TCGCGCCACATTCGCTCCGAATACACATCCATTAACCACTCAGCTGTGAAAAAGAAAATA-120

[0095] AAGAAGTGAATAATGGCCGCTTCGCGTGCAACGTTTGTTGCGCTCGTGTGCGCTCTCGCG-180

[0096] CTCGCCGCCGCCGATGTGCAGAATCCGCTCAGTGACGATTTCATCAATCTCATCAACACA-240

[0097] AAGCAAAACTCTTGGAAAGCTGGTAGGAACTTCCCAGAGCACACGCCCTTCGCACACATC-300

[0098] AAGAGATTAGCGGGTGTCCTGCCAGATTACCATTTGTCTAAATTAAGCAAAGTTGAACAT-360

[0099] GAAGA...

Embodiment 2

[0135] Embodiment 2. Cloning method of cathepsin B cDNA gene of cotton bollworm

[0136] Cotton bollworm (Helicoverpa armigera), field collection or artificial rearing.

[0137] 1. Total RNA or mRNA extraction: use one-step method or RNA kit to extract total RNA or use mRNA kit to separate and extract mRNA

[0138] 2. cDNA first-strand synthesis: 5-10 micrograms of total RNA, plus 20 microliters of reaction solution (50 millimoles potassium chloride, 3 millimoles magnesium chloride), 10 millimoles tris-hydrochloric acid buffer (Tris -HCl) pH 8.3, 1 millimolar dithiothreitol (DTT), 5 micromolar oligodeoxythymonucleotide (Oligod(T) 17 ), 500 micromole deoxyribonucleotide mixture (dNTP), 25 units of RNase inhibitor, 8 units of AMV reverse transcriptase) were reacted at 42°C for 90 minutes. The reaction was terminated at 70°C for 10 minutes.

[0139] 3. PCR reaction: polymerase chain reaction (PCR) reagents and conditions:

[0140] First mix the following reagents together:

...

Embodiment 3

[0154] Embodiment 3. Expression method of cathepsin B cDNA gene of cotton bollworm

[0155] Expression primers:

[0156] Forward HCBpGEXF 5'AATAGAATTCATGGCCGCTTCGCG 3'

[0157] Reverse HCBpGEXR 5' TCGGCTCGAGCTAATATTCAACG 3'

[0158] The cathepsin B gene of the cotton bollworm is put into Escherichia coli or other prokaryotic organisms to express, and the active protease is obtained, which is used for medicine, health care, industrial production or insecticide.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A cathepsin B gene of bollworm and its clone and recombinant expression process are disclosed. Its preparing steps include extracting overall RNA from bollworm, reverse transcription to synthesize cDNA, designing primer, polymerase chain reaction, multiplication purifying, cloning it to pGEM-T Easy vector, transferring DH5 alpha cells for sequence test, fast multiplication to obtain end-to-end CDNA (1310 bp), and expressing proteinase in prokaryotic and eukaryotic organisms to generate cathepsin B with hydrolysis activity.

Description

(1) Technical field [0001] The invention relates to a cotton bollworm cathepsin BcDNA gene and its cloning and recombinant expression technology, belonging to the fields of molecular biology and biotechnology. (2) Background technology [0002] Proteases can cleave peptide bonds and hydrolyze proteins, and are divided into four categories: serine proteases, metalloproteases, aspartic proteases and cysteine ​​proteases. Protease plays an important role in various life activities in organisms. In addition to general proteolysis, it also participates in various important life activities such as zymogen modification, antigen activation, cell apoptosis, and proteolysis under pathological conditions. Many pathogenic insecticidal microorganisms also release proteases to hydrolyze insect epidermis, enter the insect body, or release protease after entering the insect body, causing the insect body to vacuole and fester and die. Cathepsin B belongs to the cysteine ​​protease class of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/50C12N9/64C12N15/57C12N15/63C12Q1/68
Inventor 赵小凡王金星
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com