Keratinocyte growth factor-2

A host cell, encoding technology, applied in the field of use, inhibiting the effect of this polypeptide, new mutant form, keratinocyte growth factor, and purifying KGF-2 polypeptide

Inactive Publication Date: 2002-10-02
HUMAN GENOME SCI INC
View PDF174 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In normal individuals, it is not difficult to achieve the purpose of healing wounds

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Keratinocyte growth factor-2
  • Keratinocyte growth factor-2
  • Keratinocyte growth factor-2

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0164] Epitope-bearing peptides and polypeptides of the invention can be produced by any conventional method for preparing peptides or polypeptides, including recombinant methods using nucleic acid molecules of the invention. For example, short epitope-bearing amino acid sequences can be fused to larger polypeptides that can be used as vectors during recombinant production and purification, and to generate anti-peptide antibodies during immunization. Epitope-bearing peptides can also be synthesized using known chemical synthesis methods. For example, Houghten described a simple method for the synthesis of large numbers of peptides, as 10-20 mg of 248 different peptides representing single amino acid variants of a segment of the HA1 polypeptide were prepared and characterized (by ELISA-type binding studies) within 4 weeks. 13-residue peptides, Houghten, R.A (1985), A general method for rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody int...

example

[0578] According to the present invention, any method used in the art for gene therapy can be used. The instance methods are described below.

[0579] For an overview review of gene therapy, see Goldspiel et al., Clinical Pharmacy 12:488-505 (1993); Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Pharmacology and Toxicology Ann. Rev. Pharmacol. Toxicol. 32: 573-596 (1993); Mulligan, Science 260: 926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. ) 62: 191-217 (1993); May, Trends in Biotechnology (TIBTECH 11) (5): 155-215 (1993). Applicable recombinant DNA technology methods generally known in the art are described in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, New York (1993); and Kriegler, Gene Transfer and Expression , Gene Transfer and Expression, A Laboratory Manual, Stockton Press, New York (1990).

[0580] In a preferred aspect, the compound includes a nucleic acid sequence encoding an antibody, and the nucleic acid seq...

Embodiment 1

[0757] Bacterial expression and purification of embodiment 1KGF-2

[0758] The DNA sequence ATCC #75977 encoding KGF-2 was first amplified with PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the processed KGF-2 cDNA (including the signal peptide sequence). The 5' oligonucleotide primer contained the sequence 5'CCCCACATGTGGAAATGGATACTGACACATTGTGCC3' (SEQ ID NO. 3) containing an Afl III restriction enzyme site including and followed by KGF-2 starting from the putative start codon 30 nucleotides of the coding sequence. The 3' sequence 5'CCCAAGCTTCCACAAACGTTGCCTTCCTCTATGAG3' (SEQ ID NO. 4) contains the complement of the Hind III site followed by 26 nucleotides of KGF-2. These restriction enzyme sites are compatible with the restriction enzyme sites on the bacterial expression vector pQE-60 (Qiagen, Inc. Chatsworth, CA). pQE-60 encodes antibiotic resistance (AMpr), a bacterial origin of replication (ori), IPTG-regulated promoter oper...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
Login to View More

Abstract

The present invention relates to various newly identified polynucleotides, polypeptides encoded by such polynucleotides, uses of such polynucleotides and polypeptides, and production of such polynucleotides and polypeptides. More specifically, the polypeptide of the present invention is keratinocyte growth factor, sometimes referred to hereinafter as "KGF-2," and formerly referred to as fibroblast growth factor 12 (FGF-12). The present invention also relates to the therapeutic use of KGF-2 for promoting or accelerating wound healing. The present invention also relates to new mutant forms of KGF-2 which show enhanced activity, increased stability, higher yield or better solubility.

Description

field of invention [0001] The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, uses of such polynucleotides and polypeptides, and production of such polynucleotides and polypeptides. More specifically, the polypeptide of the present invention is a keratinocyte growth factor, sometimes referred to hereinafter as "KGF-2," and formerly referred to as fibroblast growth factor 12 (FGF-12). The invention also relates to inhibiting the action of such polypeptides. The present invention also relates to the therapeutic use of KGF-2 to promote or accelerate wound healing. The present invention also relates to new mutant forms of KGF-2 which show enhanced activity, increased stability, higher yield or better solubility. Additionally, the present invention relates to methods of purifying KGF-2 polypeptides. Background of the invention [0002] The fibroblast growth factor family is a large family of gr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/09A61K31/7088A61K35/76A61K38/00A61K38/16A61K38/17A61K38/18A61K48/00A61P1/00A61P1/02A61P1/04A61P1/16A61P1/18A61P3/04A61P3/06A61P3/10A61P5/00A61P7/02A61P7/04A61P7/06A61P9/00A61P9/04A61P9/06A61P9/10A61P9/12A61P11/00A61P11/06A61P13/02A61P13/08A61P13/10A61P13/12A61P15/00A61P15/02A61P15/06A61P15/08A61P15/14A61P17/00A61P17/02A61P17/06A61P19/00A61P19/02A61P21/02A61P21/04A61P25/02A61P25/06A61P25/08A61P25/14A61P25/16A61P25/28A61P27/02A61P29/00A61P31/04A61P31/10A61P31/12A61P33/00A61P35/00A61P37/02A61P37/08A61P43/00C07K14/47C07K14/475C07K14/50C12N1/15C12N1/19C12N1/21C12N5/10C12N15/12C12N15/16C12N15/63C12N15/64C12P21/02C12R1/19
CPCA61K38/00A61P1/00A61P1/02A61P1/04A61P1/16A61P1/18A61P3/04A61P3/06A61P3/10A61P5/00A61P7/02A61P7/04A61P7/06A61P9/00A61P9/04A61P9/06A61P9/10A61P9/12A61P11/00A61P11/06A61P13/02A61P13/08A61P13/10A61P13/12A61P15/00A61P15/02A61P15/06A61P15/08A61P15/14A61P17/00A61P17/02A61P17/06A61P19/00A61P19/02A61P21/02A61P21/04A61P25/02A61P25/06A61P25/08A61P25/14A61P25/16A61P25/28A61P27/02A61P29/00A61P31/04A61P31/10A61P31/12A61P33/00A61P35/00A61P37/02A61P37/08A61P43/00C07K14/50C07K14/47
InventorS·M·卢本P·金米尼兹D·R·杜安M·A·兰比D·门德里克J·张J·倪P·A·摩尔T·A·克里曼J·R·格鲁伯P·J·迪伦R·L·简茨
OwnerHUMAN GENOME SCI INC