Unlock instant, AI-driven research and patent intelligence for your innovation.

Tobacco calmodulin dependent protein kinase gene, protein and its prepn and application

A technology of protein kinase and calmodulin, applied in the field of molecular biology, to achieve the effect of beneficial accumulation, prolonging the growth cycle of plants, and prolonging the growth cycle

Inactive Publication Date: 2003-02-26
WUHAN UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But before the application of the present invention, no one has disclosed or published the purposes of plant calmodulin-dependent protein kinase gene in plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco calmodulin dependent protein kinase gene, protein and its prepn and application
  • Tobacco calmodulin dependent protein kinase gene, protein and its prepn and application
  • Tobacco calmodulin dependent protein kinase gene, protein and its prepn and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0022] Embodiment 2 (carrier member)

Embodiment 3

[0023] Three primers were used in this experiment, namely: T6E5: CGGATCCTGAAGTGGAC TTTGACTGGCCG; T6F3: CGGATCCTTATCGATGATGTCTTGTGCTTGAAC; T6P3: CGGATCCTTATAAAACAGGATTTTCCGTCCTTAACC. Using T6E5 / T6F3 and T6E5 / T6P3 as primer combinations and NtCaMK1 as template DNA, the full-length NtCaMK1 was synthesized by PCR (94 degrees Celsius for 53 minutes, 94 degrees Celsius for 1 minute, 65 degrees Celsius for 50 seconds, 72 degrees Celsius for 1 minute and 30 seconds, 30 cycles, and 72 degrees Celsius for 10 minutes). (NtCaMK1r) and NtCaMK1 without the 3' end (NtCaMK1t). The DNA fragment digested with the restriction endonuclease BamH1 was cloned into the plasmid PMD, and its insert was identified by DNA sequencing. pNtCaMK1f contains a sequence encoding the full-length 599 amino acids of NtCaMK1, and the sequence of pNtCaMK1t only encodes the N-terminal 443 amino acid residues of NtCaMK1. Embodiment 3 (the component of Bac to Bac baculovirus expression vector, objective gene is cloned...

Embodiment 6

[0163] imidazole; 10 mM β-mercaptoethanol; 10% glycerol) to elute protein. D. to collect. Embodiment 5 (transformation and screening of plants) Agrobacterium transformation of tobacco A. Preparation of sterile seedlings: seeds are treated with 70% ethanol for 30sec, ddH 2 O washing, soaking in 5% NaClO for 30min, ddH 2After O washing 5 times, spread in MS medium (PH5.8), agar concentration 0.8%. Tobacco sterile vaccine spare. B. Tobacco leaf disk transformation: Inoculate LBA4404 (containing pBl121 / NtCaMK1) on solid medium YM, pick a single colony and culture it in 50ml YM liquid medium two days later. Take the leaves of sterile seedlings, keep the midrib, cut into leaf disks of different sizes, and soak them in the bacterial solution for 10. The upper epidermis of the leaf is facing down, placed on the co-culture medium, 6-7 pieces per dish, and co-cultured for 2-3 days. C. After co-cultivation, the leaves were washed twice with liquid MS medium, and then washed once wit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention features that the tobacco mRNA is first extracted and the tobacco mRNA library is established, and MCK1 (Maize calmodulin kinase gene) is then utilized as the probe for screening, and from the screened positive cloning sequencing the whole gene sequence is obtained. After cloning gene to FfastHTb donor plasmid, recombining plastocont DNA to convert Sf9 cell, collecting recombinant virus and fusing virus infected cell, the cell is collected after 72 hr and the fusion protein is purified. The transgenic plant exhibits later blossoming characteristic and longer growth period, and tobacco calmodulin dependent protein kinase gene may be used in tobacco.

Description

technical field [0001] The invention belongs to the field of molecular biology. Specifically, the invention relates to a tobacco calmodulin-dependent proteokinase gene, a protein encoded by it, and a preparation method of the gene and the protein. At the same time, the invention also relates to the use of the calmodulin-dependent protein kinase gene in tobacco. technical background [0002] During plant development, Ca 2+ Plays a very important role by interacting with its target protein, two well-studied plant Ca 2+ The target proteins are calcium-dependent protein kinases (CDPKs) and calmodulin (CaM). A variety of CDPKs have been analyzed biochemically and molecularly, and their functions in plant physiology and development have been explored. The same research on CaM also shows that it is involved in plant development and environmental response. However, there are few studies on the function of CaM-binding proteins in plants, especially the functi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01H1/00C12N9/12C12N15/54C12N15/82
Inventor 吕应堂梁述平华玮
Owner WUHAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More