Tobacco calmodulin dependent protein kinase gene, protein and its prepn and application
A technology of protein kinase and calmodulin, applied in the field of molecular biology, to achieve the effect of beneficial accumulation, prolonging the growth cycle of plants, and prolonging the growth cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0022] Embodiment 2 (carrier member)
Embodiment 3
[0023] Three primers were used in this experiment, namely: T6E5: CGGATCCTGAAGTGGAC TTTGACTGGCCG; T6F3: CGGATCCTTATCGATGATGTCTTGTGCTTGAAC; T6P3: CGGATCCTTATAAAACAGGATTTTCCGTCCTTAACC. Using T6E5 / T6F3 and T6E5 / T6P3 as primer combinations and NtCaMK1 as template DNA, the full-length NtCaMK1 was synthesized by PCR (94 degrees Celsius for 53 minutes, 94 degrees Celsius for 1 minute, 65 degrees Celsius for 50 seconds, 72 degrees Celsius for 1 minute and 30 seconds, 30 cycles, and 72 degrees Celsius for 10 minutes). (NtCaMK1r) and NtCaMK1 without the 3' end (NtCaMK1t). The DNA fragment digested with the restriction endonuclease BamH1 was cloned into the plasmid PMD, and its insert was identified by DNA sequencing. pNtCaMK1f contains a sequence encoding the full-length 599 amino acids of NtCaMK1, and the sequence of pNtCaMK1t only encodes the N-terminal 443 amino acid residues of NtCaMK1. Embodiment 3 (the component of Bac to Bac baculovirus expression vector, objective gene is cloned...
Embodiment 6
[0163] imidazole; 10 mM β-mercaptoethanol; 10% glycerol) to elute protein. D. to collect. Embodiment 5 (transformation and screening of plants) Agrobacterium transformation of tobacco A. Preparation of sterile seedlings: seeds are treated with 70% ethanol for 30sec, ddH 2 O washing, soaking in 5% NaClO for 30min, ddH 2After O washing 5 times, spread in MS medium (PH5.8), agar concentration 0.8%. Tobacco sterile vaccine spare. B. Tobacco leaf disk transformation: Inoculate LBA4404 (containing pBl121 / NtCaMK1) on solid medium YM, pick a single colony and culture it in 50ml YM liquid medium two days later. Take the leaves of sterile seedlings, keep the midrib, cut into leaf disks of different sizes, and soak them in the bacterial solution for 10. The upper epidermis of the leaf is facing down, placed on the co-culture medium, 6-7 pieces per dish, and co-cultured for 2-3 days. C. After co-cultivation, the leaves were washed twice with liquid MS medium, and then washed once wit...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap