Fushion protein of melittin with gene mutant interleukin -2
A technology of interleukin and chimera, which is applied in the amino group field of protein, can solve the side effects of hemolysis and other problems, achieve the effects of reducing toxic side effects, improving therapeutic effect, and enhancing lethality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0033] Embodiment 1, construct the cloning of melittin and gene allosteric IL-2 chimeric protein
[0034] Using spliced overlap extension (SOE) technology, IL-2 was modified at a specific site to obtain gene allosteric IL-2 clone; using SOE technology, 26 peptide melittin and gene allosteric IL-2 were obtained. 2 is connected at the gene level, and what is used to connect two coding genes is a connecting peptide Gly-Gly-Gly-Ser composed of four amino acid residues that are easy to form a spatial structure.
[0035] The coding gene sequence of melittin and gene allosteric IL-2 chimeric protein:
[0036] ggaattggagcagttctgaaggtattaaccacaggattgcccgccctcataagttggat
[0037]taaacgtaagaggcaacagggtggaggcggttcaggtggaggtggctctggcggaggcg
[0038] gatcggcacctacttcaagttctacaaagaaaacacagctacaactggagcatttactt
[0039] ctggatttacagatgattttgaatggaattaataattacaagaatcccaaactcaccag
[0040] gatgctcacatttaagttttacatgcccaagaaggccacagaactgaaacatcttcagt
[0041] gtctagaagaagaagaactcaaacctctgg...
Embodiment 2
[0049] Embodiment 2, construct the expression vector that contains melittin and gene allosteric IL-2 chimeric protein
[0050] (1) Construction of prokaryotic expression vector
[0051] The PCR amplification product of the 26-peptide melittin and the gene allosteric IL-2 chimera and the prokaryotic expression plasmid pGEX4T-2 (Promega Company) were digested with restriction endonucleases SalI and EcoRI (Promega Company) in a water bath at 37°C for 4h Finally, under the action of T4 ligase (Promega Company), the recombinant plasmid was constructed by ligation. The pGEX4T-2 recombinant plasmid inserted into the target gene was transformed into the host strain Escherichia coli DH5α to construct the prokaryotic expression system.
[0052] (2), construction of eukaryotic expression vector
[0053] The PCR amplification product of 26-peptide melittin and gene allosteric IL-2 chimeric protein and the eukaryotic expression plasmid pPICZαB (Invitrogen Company) were digested with rest...
Embodiment 3
[0054] Embodiment 3, prokaryotic and eukaryotic expression and protein purification of chimeric protein
[0055] (1) Prokaryotic expression and purification
[0056] Pick the host strain DH5α containing the pGEX4T-2 recombinant plasmid inserted into the target gene and inoculate it in LB culture medium (containing 100g / ml ampicillin), and cultivate it with shaking at 37°C until OD 600 About 0.2. Add the inducer IPTG to the final concentration of 1mmol / L, and continue to culture at 37°C for 4h. Collect the bacterial liquid, after centrifugation, resuspend the bacterial plaque with SDS loading buffer, after 5 minutes at 100 ° C, the sample is electrophoresed on the SDS-PAGE gel for about 3 hours, and the PAGE gel is soaked in Coomassie brilliant blue In the protein staining solution, put on a horizontal shaker for 2 hours, and the expression of the fusion protein can be observed after decolorization. B-PER produced by PIERCE company @ GST Fusion Protein Purification Kit (Lot...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com