Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fushion protein of melittin with gene mutant interleukin -2

A technology of interleukin and chimera, which is applied in the amino group field of protein, can solve the side effects of hemolysis and other problems, achieve the effects of reducing toxic side effects, improving therapeutic effect, and enhancing lethality

Inactive Publication Date: 2006-04-05
QINGDAO UNIV
View PDF0 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although the cytokine IL-2 and bee venom alone have been used to treat tumors alone, and have achieved certain curative effects, the application of bee venom extracted from honeybees has hemolytic side effects, which limits its application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1, construct the cloning of melittin and gene allosteric IL-2 chimeric protein

[0034] Using spliced ​​overlap extension (SOE) technology, IL-2 was modified at a specific site to obtain gene allosteric IL-2 clone; using SOE technology, 26 peptide melittin and gene allosteric IL-2 were obtained. 2 is connected at the gene level, and what is used to connect two coding genes is a connecting peptide Gly-Gly-Gly-Ser composed of four amino acid residues that are easy to form a spatial structure.

[0035] The coding gene sequence of melittin and gene allosteric IL-2 chimeric protein:

[0036] ggaattggagcagttctgaaggtattaaccacaggattgcccgccctcataagttggat

[0037]taaacgtaagaggcaacagggtggaggcggttcaggtggaggtggctctggcggaggcg

[0038] gatcggcacctacttcaagttctacaaagaaaacacagctacaactggagcatttactt

[0039] ctggatttacagatgattttgaatggaattaataattacaagaatcccaaactcaccag

[0040] gatgctcacatttaagttttacatgcccaagaaggccacagaactgaaacatcttcagt

[0041] gtctagaagaagaagaactcaaacctctgg...

Embodiment 2

[0049] Embodiment 2, construct the expression vector that contains melittin and gene allosteric IL-2 chimeric protein

[0050] (1) Construction of prokaryotic expression vector

[0051] The PCR amplification product of the 26-peptide melittin and the gene allosteric IL-2 chimera and the prokaryotic expression plasmid pGEX4T-2 (Promega Company) were digested with restriction endonucleases SalI and EcoRI (Promega Company) in a water bath at 37°C for 4h Finally, under the action of T4 ligase (Promega Company), the recombinant plasmid was constructed by ligation. The pGEX4T-2 recombinant plasmid inserted into the target gene was transformed into the host strain Escherichia coli DH5α to construct the prokaryotic expression system.

[0052] (2), construction of eukaryotic expression vector

[0053] The PCR amplification product of 26-peptide melittin and gene allosteric IL-2 chimeric protein and the eukaryotic expression plasmid pPICZαB (Invitrogen Company) were digested with rest...

Embodiment 3

[0054] Embodiment 3, prokaryotic and eukaryotic expression and protein purification of chimeric protein

[0055] (1) Prokaryotic expression and purification

[0056] Pick the host strain DH5α containing the pGEX4T-2 recombinant plasmid inserted into the target gene and inoculate it in LB culture medium (containing 100g / ml ampicillin), and cultivate it with shaking at 37°C until OD 600 About 0.2. Add the inducer IPTG to the final concentration of 1mmol / L, and continue to culture at 37°C for 4h. Collect the bacterial liquid, after centrifugation, resuspend the bacterial plaque with SDS loading buffer, after 5 minutes at 100 ° C, the sample is electrophoresed on the SDS-PAGE gel for about 3 hours, and the PAGE gel is soaked in Coomassie brilliant blue In the protein staining solution, put on a horizontal shaker for 2 hours, and the expression of the fusion protein can be observed after decolorization. B-PER produced by PIERCE company @ GST Fusion Protein Purification Kit (Lot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fusion protein of melittin and human mutant interleukin-2, which is characterized in that, a linker peptide gene is used to link the encoding genes of human mutant IL-2 and melittin. The invention can be used to screen cloning capable of improving CD8+T cell mediated CTL reactivity of the body after the tumor formation, the fusion protein can be used fine genetic medicament for the treatment of tumors.

Description

technical field [0001] The invention relates to a chimeric DNA sequence of cytokine interleukin 2 (IL-2) gene and melittin gene encoded by a Chinese genome cDNA library and genetically restructured with potential medical uses, and determined by the sequence The amino acid primary structure sequence of the chimeric protein, as well as a new preparation with the effect of killing tumor cells - chimeric protein, belong to the technical field of medical bioengineering. Background technique [0002] Malignant tumors are one of the major diseases that currently threaten human life and health. Currently, most of the widely used drugs for treating tumors are some cytokines with immunoregulatory effects: such as interleukin 2, interleukin 6, interferon, etc. . Interleukin 2 (IL-2) is secreted by activated T cells in vivo, and has a variety of biological activities related to immune function enhancement: inducing T cell proliferation and differentiation; enhancing CTL cytotoxicity; p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C12N15/26C12N15/11C07K14/00C07K14/435C12N15/63C07K19/00
Inventor 王斌钱冬萌闫志勇丁守怡宋旭霞
Owner QINGDAO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com