Treatment of IgA1 deposition diseases

A DNA sequence and coding technology, applied in skin diseases, blood diseases, bone diseases, etc., can solve problems such as non-specific IgA1 molecules

Active Publication Date: 2006-05-24
NEW ENGLAND MEDICAL CENT HOSPITALS
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Proteases, chymopapain, and subtilisin act by proteolytically cleaving IgA1 deposits in the kidney, but are not specific for IgA1 molecules and digest a variety of other proteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Treatment of IgA1 deposition diseases
  • Treatment of IgA1 deposition diseases
  • Treatment of IgA1 deposition diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0143] Example 1. Construction of tagged IgA1 protease

[0144] The His-tag was fused in frame to the H. influenzae IgA1 protease by PCR-based site-directed mutagenesis using plasmid pFG26 containing the DNA sequence encoding the H. influenzae IgA1 protease. As shown in Figure 4, two PCR fragments were generated from pFG26. Using the oligonucleotide primers "HFD6His1" (Primer 1) and "HFD6His2" (Primer 2) shown below generated the first fragment, the XbA1 and pml1 fragments. A second fragment, the pmL I and Acc I fragments, was generated using primers 3 and 4 shown below.

[0145] Primer 2: HFD-5XbaI: 5'GATCCGCTTACCAATTATGC 3' (SEQ ID NO: 20)

[0146] Primer 2: HFD6His1:

[0147] 5'CTTGGTACGCTAGGCACGTGATGATGATGATGATGAGGTGTTGTGATATTT

[0148] GTCG-3' (SEQ ID NO: 21)

[0149] Primer 2: HFD6His2: 5'-CCTAATAATATTCAAGCTCACGTGCCTAGCGTACC-3'

[0150] (SEQ ID NO: 22)

[0151] Primer 2: HFD-F-ACCI: 5'-TTCAGCAGAAGTCTCTTGC-3' (SEQ ID NO: 23)

[0152]After amplifying the two fragme...

Embodiment 2

[0153] Example 2. Generation of bacterial strains expressing tagged IgA1 protease

[0154] Haemophilus influenzae bacterial strains expressing only the tagged, enzymatically active IgA1 protease were generated by conventional recombinant techniques. Briefly, the plasmid pJQ / Rd6His produced in Example 1 was cut with restriction enzymes Cla I and NdeI. The gene was isolated and transformed into the Haemophilus influenzae Rd strain (Rd3-13) producing an enzymatically inactive IgA1 protease (Plaut AG, Qiu, J, Grundy, F. and Wright, A.J Infect Dis. (1992) Jul. ; 166(1):43-52), so that the His-tagged IgAl protease is inserted into the bacterial genome by recombination. Bacteria for restoring enzymatic activity were screened by verifying the presence of active protease in the bacterial growth medium of selected clones using human IgAl as a substrate.

[0155] Introduction of the 6-His mutation into the active enzyme was confirmed using PCR fragments of genomic DNA to verify the pre...

Embodiment 3

[0159] The therapeutic effect of IgA1 protease for treating IgA nephropathy can be verified in the IgA nephropathy mouse model.

[0160] Multiple Swiss-Webster mice (Charles River Laboratories) were used per experiment and grouped (typically 10 mice / group). The mice were first placed in metabolic cages and urine was collected for 24 hours to measure the amount of hematuria (red blood cells in the urine) and proteinuria (proteins in the urine) in the urine. This provides baseline values ​​for hematuria and proteinuria in normal healthy mice. IgA nephropathy was then induced in mice as described in Gesualdo L. et al, (1990) J. Clin. Invest. 86:715-722.

[0161] After inducing nephropathy, mice were intraperitoneally injected with multiple doses of saline (control), inactive IgA1 protease (control), active IgA1 protease, and IgA1 protease complexed with immunoglobulin (such as complexed with anti-tag antibody or anti-IgA1 protease antibody). An exemplary dosing regimen includes...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses the use of bacterial IgA1 proteases to treat IgA1 deposition in tissue and organs. Bacterial IgA1 proteases specifically cleave IgA1 molecules and thus provide a means to specifically cleave and remove IgA1 depositions. Accordingly, therapeutic agents for the treatment of diseases characterized by IgA deposition are provided. In particular, therapeutic agents to treat IgA nephropathy, Dermatitis herpetiformis (DH), and Henoch-Schoenlein purpura (HS) are disclosed.

Description

[0001] Government funding [0002] This invention was funded in whole or in part by grant NIH RO1 DE 09677 from NIH, NIDCR. The US Government has certain rights in this invention. Background technique [0003] Immunoglobulin Al (IgAl) deposition in human tissues and organs is a feature of many human diseases including IgA nephropathy, dermatitis herpetiformis (DH) and Henoch-Schoenlein purpura (HS). IgA1 deposition is associated with various clinical manifestations such as renal failure, skin blisters, rashes, arthritis, gastrointestinal bleeding, and abdominal pain. [0004] Several treatment options exist for patients exhibiting abnormal IgAl deposition. They include the administration of corticosteroids with immunosuppressive and anti-inflammatory properties, dietary fish oil supplementation to reduce nephritis, and angiotensin-converting enzyme inhibitors to reduce the risk of progressive renal disease and renal failure. These treatments do not act directly on IgAl depo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/64A61KA61K6/00A61K39/395C12N9/00C12N9/52
CPCC07K2319/21C07K2319/40C07K2319/42C07K2319/43C12N9/52A61P13/12A61P17/00A61P17/02A61P19/02A61P37/00A61P37/02A61P43/00A61P7/04A61P9/00C12N9/64A61K6/00
Inventor安德鲁·G·普劳特仇家舟
OwnerNEW ENGLAND MEDICAL CENT HOSPITALS