Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel thrombase-like gene and its use

A thrombin-like and gene technology, applied to new thrombin-like genes and their application fields, can solve the problems of shortage of snake resources, low product purity, restricting the research and utilization of enzyme components, etc.

Inactive Publication Date: 2006-06-07
SUN YAT SEN UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] However, there is no literature report on the production and use of Agkistrodon akistrodon thrombin as a hemostatic drug
[0009] Agkistrodon halys contains a large amount of blood toxins and enzyme resources. However, the traditional biochemical extraction method has high production costs, low product purity, and the shortage of snake resources caused by the deteriorating global ecological environment. This restricts the research and utilization of various enzyme components in snake venom

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel thrombase-like gene and its use
  • Novel thrombase-like gene and its use
  • Novel thrombase-like gene and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Extraction and RT-PCR amplification of total RNA from Agkistrodon venom gland

[0036] Extraction of total RNA and synthesis of cDNA: The total RNA of the venom gland of Agkistrodon akistrodon was extracted by one-step hot phenol method, and the protein was removed by extraction. To obtain a total RNA concentration of 3.9 μg / μl, its A 260 / A 280 =1.9, two clear bands of 18s and 28s can be seen by 1% agarose electrophoresis (see Figure 2), indicating that the integrity of the total RNA is good. Take 1ug of total RNA with SMART III olignuclotide (5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG-3') and CDSIII / 3'PCR primers (5'-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T) 30 N -1 Each 1ul of N-3′) was reverse-transcribed to synthesize the first strand to obtain 10 μl of cDNA first-strand product. 2μl of the first-strand product was washed with 5’PCR primer (5’-AAGCAGTGGTATCAACGCAGAGT-3’), CDS III / 3’PCR primer (5’-ATTCTAGAGGCCGAGGCGGCCGACATGd(T) 30 N -1 N-3') for second stra...

Embodiment 2

[0037] Example 2: Sequence analysis of the thrombin-like gene in the venom gland of Agkistrodon akistrodon

[0038] Blast homology analysis showed that the nucleotide sequence of the new thrombin-like gene of Agkistrodon venom gland shared 87% with a serine protease from Trimeresurus gramineus and a stejnobin sequence from Trimeresurus stejnegeri in China. Homology, 86% homology with American lancehead Agkistrodon (Bathrops jararaca). The protein sequence of TLE has the highest homology (72%) with the amino acid sequence encoded by stejnobin of Chinese bamboo leaf green snake (Trimeresurus stejnegeri). The homology of the enzyme gene is not the highest, and among the 13 thrombin-like genes reported by Agkistrodon acutobin, it has the highest homology (68%) with Acutobin precursor (Acutrombin / Acutase). The TLE amino acid sequence has the typical characteristics of thrombin-like enzymes from other snake venoms, and contains a catalytic triplet conserved in serine proteases: His...

Embodiment 3

[0039] Example 3: Construction of Yeast Secreted Expression Plasmid of Agkistrodon Agkistrom-like Thrombin

[0040] A pair of primers were synthesized according to the sequences at both ends of the tle gene, the upstream primer contained the Xho I cleavage site, and the downstream primer contained the NotI cleavage site.

[0041] Upstream primer (B1):

[0042] -CCG CTCGAGAAAAGAGAGGCTGAAGCTGTCATTGGAGGTAATGAATGTAAC -

[0043] Xho I 3'end ofα-Factor signal sequence Mature TLE

[0044] Downstream primer (B2):

[0045] -TGC TCTAGA TAACTTCTTCAAAAGTTTCACGG

[0046] The pcDNA3.0 plasmid containing the tle gene was used as a template, and B1 and B2 were used as primers for PCR amplification, and a single specifically amplified band was obtained, and the product size was about 122 bp (Figure 3). The PCR was about 800 bp, and the amplified product was digested with XhoI / NotI and cloned into the Pichia pastoris expression vector pPICZαA to obtain the recombinant expression vector p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a new kind of thrombin-like enzyme gene and its application. By means of RT¿CPCR process, thrombin-like enzyme gene tle, which has DNA sequence as shown in <400>1 sequence in the sequence list, is screened out from total RNA of Agkistrodon acutus venom gland. The gene coded proten thrombin-like enzyme (TLE) has amino acid sequence as shown in <400>2 sequence in the sequence list. The recombinant thrombin-like enzyme has both blood coagulation and hemostasis acitivity, and may be used in preparing medicine for treating vanous thrombosis, cerebral thrombosis and other vascular embolus diseases.

Description

technical field [0001] The present invention relates to a novel thrombin-like enzyme (TLE) and gene tle encoding the protein, and the application of the protein in the preparation of medicines for treating venous thrombosis, cerebral thrombosis and other vascular embolism diseases. . Background technique [0002] Agkistrodon acutus (Deinagkistrodon acutus, Gunther, 1888), belongs to Viperidae (Viperidae), Viper subfamily (Crotalinae), the only species of Agkistrodon (Agkistrodon), also called five step snake, hundred step snake, thistle snake, etc. According to folklore, if you are bitten by it and walk less than a hundred steps, you will die. It is a unique snake species in my country, mainly distributed in the vast mountainous areas of Fujian, Zhejiang, Hunan, Hubei, Jiangxi, Anhui, Guangdong, Guangxi and Taiwan in the southern provinces of China. [0003] People have long regarded Agkistrodon acutus as a precious medicinal material, and the dried snake made from it has ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/57A61K38/48A61P7/02C12N9/74C12N15/81
Inventor 徐安龙刘钰山王磊任宇锋赖春娥陈尚武
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com