Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Production method of recombinant fusion protein of human serum albumin-interferon alpha 2b

A technology of human serum albumin and serum albumin, applied in biochemical equipment and methods, recombinant DNA technology, botany equipment and methods, etc., to achieve large-scale industrial production, reduce pollution and loss, and simple operation Effect

Inactive Publication Date: 2006-07-26
HANGZHOU JIUYUAN GENE ENG
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, how to prepare large-scale recombinant human serum albumin-interferon α2b fusion protein that meets the requirements of medicine has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Production method of recombinant fusion protein of human serum albumin-interferon alpha 2b
  • Production method of recombinant fusion protein of human serum albumin-interferon alpha 2b
  • Production method of recombinant fusion protein of human serum albumin-interferon alpha 2b

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0030] 1. Construction of engineering strains expressing rHSA-IFNα2b Pichia pastoris

[0031] 1. Cloning of HSA gene

[0032] Synthesize primers according to the coding sequence of HSA gene in Genebank

[0033] HSA1: 5'GCTTCGAAACCATGAAGTGGGTAACCTTTATTTCCCT3',

[0034] HSA2: 5'TAGGATCCACCACCACCAAAGGCCTAAGGCAGCTTGACTTGC3',

[0035]It is used to amplify the full-length coding sequence of HSA including the signal peptide, and a NspV restriction site is added at the 5' end, and the sequence before the start codon is consistent with the Kozak sequence of the AOX1 promoter of the pHIL-D2 vector unanimous. At the 3' end, the stop codon was removed, and the codon of the last amino acid was changed from TTA to CTT without changing the amino acid, so as to form a StuI enzyme cleavage site there. A linker sequence encoding GlyGlyGlyGlySer and a BamHI restriction site were added to the 3' end. The PCR conditions were as follows: 1 μl of human hepatic fetal cDNA library, 3 μl of 20 μmo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Specific activityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a purified rHSA-IFN alpha2b producing method of pichia fermentation liquor from expressing and restructuring albuminar-interferon alpha2b anastomosing protein, which comprise the following steps: fermenting and expressing high density pichia engineering bacteria of protein gene by integrated albuminar-interferon alpha2b anastomosing; combinating and purifying sequentially fermentation liquor with rHSA-IFN alpha2b with affinity column chromatography, hydrophobic column chromatography, ion exchange column chromatography and gel column chromatography; Getting high-purity medicinal recombination albuminar- interferon alpha2b anastomosing protein by large scale preparing. The invention operates simply and convenience.

Description

technical field [0001] The present invention relates to the application of recombinant DNA technology to produce genetically engineered protein drugs, specifically large-scale purification from the fermentation broth of Pichia pastoris high-expression engineering bacteria containing recombinant human serum albumin-interferon α2b fusion protein (rHSA-IFNα2b) gene Methods for rHSA-IFNα2b. Background technique [0002] Human serum albumin-interferon α2b fusion protein (rHSA-IFNα2b) is a long-acting interferon fused with α-interferon (Interferon-alpha) and human serum albumin (Albumin) by gene fusion technology. Compared with ordinary interferon, the average half-life of rHSA-IFNα2b in the human body is more than 30 times longer, so it can reduce the number of injections during interferon treatment and reduce the pain of treatment for patients. [0003] Interferon (Interferon, IFN) is a kind of secretory protein with broad-spectrum anti-virus, anti-tumor and immune regulation f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C12N15/14C12N15/21C12N1/19
Inventor 王同映杨志愉马国昌裘霁宛王昌梅单剑锋黄岩山
Owner HANGZHOU JIUYUAN GENE ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com