Production method of recombinant fusion protein of human serum albumin-interferon alpha 2b
A technology of human serum albumin and serum albumin, applied in biochemical equipment and methods, recombinant DNA technology, botany equipment and methods, etc., to achieve large-scale industrial production, reduce pollution and loss, and simple operation Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0030] 1. Construction of engineering strains expressing rHSA-IFNα2b Pichia pastoris
[0031] 1. Cloning of HSA gene
[0032] Synthesize primers according to the coding sequence of HSA gene in Genebank
[0033] HSA1: 5'GCTTCGAAACCATGAAGTGGGTAACCTTTATTTCCCT3',
[0034] HSA2: 5'TAGGATCCACCACCACCAAAGGCCTAAGGCAGCTTGACTTGC3',
[0035]It is used to amplify the full-length coding sequence of HSA including the signal peptide, and a NspV restriction site is added at the 5' end, and the sequence before the start codon is consistent with the Kozak sequence of the AOX1 promoter of the pHIL-D2 vector unanimous. At the 3' end, the stop codon was removed, and the codon of the last amino acid was changed from TTA to CTT without changing the amino acid, so as to form a StuI enzyme cleavage site there. A linker sequence encoding GlyGlyGlyGlySer and a BamHI restriction site were added to the 3' end. The PCR conditions were as follows: 1 μl of human hepatic fetal cDNA library, 3 μl of 20 μmo...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Specific activity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
