Prourokinase modifier, preparation method, pharmaceutical composition, use, encoding gene, carrier containing gene and transformation cell

A kind of technology of prourokinase and modified body, applied in the field of genetic engineering

Inactive Publication Date: 2007-03-07
TIANJIN TASLY PHARMA CO LTD +1
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Pro-UK itself has a weak affinity for fibrin, and there is no consensus on the mechanism by which it selectively dissolves fibrin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prourokinase modifier, preparation method, pharmaceutical composition, use, encoding gene, carrier containing gene and transformation cell
  • Prourokinase modifier, preparation method, pharmaceutical composition, use, encoding gene, carrier containing gene and transformation cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] prourokinase variant M 2 Gene construction (see the sequence listing SEQ ID NO.1 and SEQ ID NO.2 for nucleotide and amino acid sequences respectively)

[0024] 1. t-PA K 2 district construction

[0025] According to literature (Pennica, D., et al.Cloning and expression of human tissue-type plasminogenactivator cDNA in E.coli.Nature 301(5897), 214-221(1983).), K 2 The full sequence of zones is:

[0026] GTGACTGCTACTTTGGGAATGGGTCAGCCTACCGTGGCACGCACAGCCTCCACCGAG

[0027] TCGGGTGCCTCCTGCCTCCCGTGGAATTCCATGATCCTGATAGGCAAGGTTTACAC

[0028] AGCACAGAACCCCAGTGCCCAGGCACTGGGCCTGGGCAAACATAATTACTGCCGG

[0029] AATCCTGATGGGGATGCCAAGCCCTGGTGCCACGTGCTGAAGAACCGCAGGCTGA

[0030] CGTGGGAGTACTGTGATGTGCCCTCCTGCT

[0031] Synthesize K in three stages 2 template:

[0032] first paragraph:

[0033] AAGTGGATATCATGTGCTACTTTGGGAATGGGTCAGCCTACCGTGGCACGCAC

[0034] AGCCTCACCGAGTCGGGTGCCTCCTGCCTGCCG TGGAATTCCATGAT

[0035] The upstream primer is: 5'-GGATATCATGTGCTACTTTGGGAA-3' restriction...

Embodiment 2

[0076] Containing Prourokinase Modified M 2 Expression in Chinese hamster ovary cells

[0077] 1. t-PA K 2 Region construction: according to the method of Example 1.

[0078] 2. ProUK-P region construction: according to the method of Example 1.

[0079] 3. Construction of Signal+KGD+RGDS guide peptide region

[0080] Synthesize a single-stranded DNA fragment containing the Signal+KGD+RGDS sequence as a peptide guide template

[0081] GAAGCTTATGAGAGCCCTGCTGGCGCGCCTGCTTCTCTGCGTCCTGGTCCTGAGCG

[0082] ACTCCAAAGGCCGCGGCGACAGCAAGGGTGACTGGGATATCC

[0083] The upstream primer is: 5'-GAAGCTTATGAGAGCCCTGCTG-3' restriction site is HindIII

[0084] The downstream primer is: 5'-AGATATCCCAGTCACCCTTGCT-3' restriction site is EcoRV

[0085] The PCR amplification product is the Signal+KGD+RGDS guide peptide. After the amplified product was recovered and purified, it was ligated with the pGEM-Teasy vector and transformed into E.coli DH5α.

[0086] 4. pcDNA-M 2 Plasmid construction

...

Embodiment 3

[0116] Expression of Transformant M Using Insect Baculovirus Expression System 2

[0117] M 2 The gene was cloned into the insect baculovirus expression vector pFast-BacHTa, transfected into Sf9 insect cells through liposome Superfect, harvested the culture supernatant, passed through the affinity chromatography column affinity layer coupled with anti-prourokinase antibody After analysis, it was desalted and concentrated, and freeze-dried to obtain the purified prourokinase variant M 2 protein powder. SDS-PAGE electrophoresis identified that the molecular weight of the pro-urokinase variant M2 expressed in Sf9 insect cells was in line with expectations.

[0118] The affinity chromatography column coupled with anti-prourokinase antibody was provided by Shanghai Sangon Bioengineering Technology Service Co., Ltd., and the transfection method was referred to the "Molecular Cloning Experiment Guide" (Sambrool, J. et al., Huang Peitang et al. Translated, Molecular Cloning Experi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a new abbokinase modifier in the genetic engineering domain, which consists of KGD and RGDS, wherein the tPA K2 segment and abbokinase P area are induced to the N end of molecular structure, which is compatible with platelet aggregation inhibition.

Description

technical field [0001] The present invention belongs to the field of genetic engineering, in particular, relates to a prourokinase (prourokinase, referred to as pro-UK) transformant, a preparation method of the transformant, a pharmaceutical composition containing the transformant and its use, and the The transformant encodes a gene, a vector containing the gene, and a transformed cell containing the vector. Background technique [0002] In 1979, Husain et al. purified prourokinase from urine for the first time (US Patent No.4381346, 1979). Pro-urokinase, also known as single chain urine-type plasminogen activator (single chain urine-type plasminogen activator, referred to as scu-PA), is composed of 411 amino acids and is a molecular weight of 50-54Kda (the difference may be different from the produced Different cells and purification methods, resulting in differences in glycosylation levels) of single-chain protein molecules. Natural pro-UK...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/72A61K38/49A61P7/02A61P9/10C12N15/58C12N15/79C12N15/85C12P21/02
Inventor沈伟王子清高峰姜燕
OwnerTIANJIN TASLY PHARMA CO LTD