N-linked glycosylation alteration in E0 and E2 glycoprotein of classical swine fever virus and novel classical swine fever virus vaccine

a technology of vaccines, which is applied in the field of n-linked glycosylation alteration in e0 and e2 glycoproteins of novel classical swine fever virus vaccines, can solve problems such as inefficient glycosylation, and achieve the effect of delaying the onset or severity of cs

Inactive Publication Date: 2010-04-29
BORCA MANUEL +1
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0013]An additional object of the invention is to provide a rationally designed live attenuated CSFV vaccine which lessens severity of CSF disease when challenged with virulent Brescia CSFV wherein said vaccine comprises an altered glycosylation pattern as compared to that of the infectious, non-mutated virus.
[0018]An additional object of the invention is to provide a method for delaying onset or severity of CSF in an animal by administering an effective amount of rationally designed live attenuated CSFV vaccine.

Problems solved by technology

Not all predicted sites in a protein sequence are used for carbohydrates, since many of them are inefficiently glycosylated (Shakin-Eshleman et al.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • N-linked glycosylation alteration in E0 and E2 glycoprotein of classical swine fever virus and novel classical swine fever virus vaccine
  • N-linked glycosylation alteration in E0 and E2 glycoprotein of classical swine fever virus and novel classical swine fever virus vaccine
  • N-linked glycosylation alteration in E0 and E2 glycoprotein of classical swine fever virus and novel classical swine fever virus vaccine

Examples

Experimental program
Comparison scheme
Effect test

example 1

Viruses and Cell Cultures

[0088]Swine kidney cells (SK6) (Terpstra et al., supra) free of Bovine Viral Diarrhea Virus (BVDV) were cultured in Dulbecco's Minimal Essential Medium (DMEM, GIBCO, Grand Island, N.Y.) with 10% fetal calf serum (FCS, Atlas Biologicals, Fort Collins, Colo.). CSFV Brescia strain (obtained from the Animal and Plant Health Inspection Service, Plum Island Animal Disease Center) was propagated in SK6 cells and used for the construction of an infectious cDNA clone (Risatti et al. 2005a, supra). Growth kinetics were assessed on primary swine macrophage cell cultures prepared as described by Zsak et al. (1996. J. Virol. 70: 8865-8871). Titration of CSFV from clinical samples was performed using SK6 cells in 96-well plates (Costar, Cambridge, Mass.). Viral infectivity was detected, after 4 days in culture, by an immunoperoxidase assay using the CSFV monoclonal antibodies (mAbs) WH303 (Edwards et al. 1991. Vet. Microbiol. 29:101-108) and the Vectastain ABC kit (Vector...

example 2

Construction of CSFV Glycosylation Mutants

[0089]A full-length infectious clone of the virulent Brescia isolate (pBIC) (Risatti et al. 2005a, supra) was used as a template in which putative O- and N-linked glycosylation sites in the E2 glycoprotein were mutated. Glycosylation sites were predicted using analysis tools from the Center for Biological Sequence Analysis (http: / / www.cbs.dtu.dk / services / ). Mutations were introduced by site-directed mutagenesis using the QuickChange XL Site-Directed Mutagenesis kit (Stratagene, Cedar Creek, Tex.) performed per manufacturer's instructions and using the following primers (only forward primer sequences are shown); O1v: CATCATTACATMGG ACGCTTTAGCCACTTCCGTGACATTCGAGC (SEQ ID NO:4); N1v: CCCTGTAGT CAAGGGAAAGTACGCCACMCCTTGTTGAATGGTAG (SEQ ID NO:5); N2v: AAA GTACMCACMCCTTGTTGGCTGGTAGTGCATTCTACCTAGT(SEQ ID NO:6); N3v: ATTCTACTGTAAATGGGGGGGCGCTTGGACATGTGTGAAAGGTGA (SEQ ID NO:7); N4v: ATAGGTMGTGCATTTTGGCAGCTGAGACAGGTTACAGMTAGTG (SEQ ID NO:8); N5v: GAGTC...

example 3

In Vitro Rescue of CSFV Brescia and Glycosylation Mutants

[0090]Full-length genomic clones were linearized with Srfl and in vitro transcribed using the T7 Megascript system (Ambion, Austin, Tex.). RNA was precipitated with LiCl and transfected into SK6 cells by electroporation at 500 volts, 720 ohms, 100 watts with a BTX 630 electroporator (BTX, San Diego, Calif.). Cells were seeded in 12-well plates and incubated for 4 days at 37° C. and 5% CO2. Virus was detected by immuno-peroxidase staining as described above, and stocks of rescued viruses were stored at −70° C.

[0091]Infectious RNA was in vitro transcribed from full-length infectious clones of the CSFV Brescia strain or a set of glycosylation mutants (Table 1, FIG. 1) and used to transfect SK6 cells. Mutants referred to as O1, N1, N2, N3, N4, N5, and N6 represent each of seven putative glycosylation sites starting from the N terminus of E2 (Table 1), whereas multiple mutants are represented by combinations of indicated sites (FIG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Timeaaaaaaaaaa
Timeaaaaaaaaaa
Login to View More

Abstract

E2 is one of the three envelope glycoproteins of Classical Swine Fever Virus (CSFV). E2 is involved in several functions including virus attachment and entry to target cells, production of antibodies, induction of protective immune response in swine, and virulence. Seven putative glycosylation sites in E2 were modified by site directed mutagenesis of a CSFV Brescia infectious clone (BICv). A panel of virus mutants was obtained and used to investigate whether the removal of putative glycosylation sites in the E2 glycoprotein would affect viral virulence / pathogenesis in swine. We observed that rescue of viable virus was completely impaired by removal of all putative glycosylation sites in E2, but restored when mutation N185A reverted to wild-type asparagine produced viable virus that was attenuated in swine. Single mutations of each of the E2 glycosylation sites showed that amino acid N116 (N1v virus) was responsible for BICv attenuation. N1v efficiently protected swine from challenge with virulent BICv at 3 and 28 days post-infection suggesting that glycosylation of E2 could be modified for development of CSF live-attenuated vaccines. Additionally, a new developed virus, contained deletions of putative glycosylation sites N1 in E2 and N1 in E0 (6b), called N1E0 / 2v, induce a solid protection against the challenge at 3 and 28 days post-inoculation.

Description

BACKGROUND OF THE INVENTION[0001]1. Field of the Invention[0002]This invention relates to the characterization of the role that glycosylation of the transmembrane glycoprotein E2 of highly virulent Classical Swine Fever Virus (CSFV) strain Brescia plays during infection in the natural host and to the utilization of a strategy for manipulating the pattern of glycosylation for particular E2 glycosylation sites in order to alter CSFV virulence, providing a useful tool in the design and development of CSF live-attenuated vaccines.[0003]2. Description of the Relevant Art[0004]Classical swine fever (CSF) is a highly contagious disease of swine. The etiological agent, CSF virus (CSFV), is a small, enveloped virus with a positive, single-stranded RNA genome and, along with Bovine Viral Diarrhea Virus (BVDV) and Border Disease Virus (BDV), is classified as a member of the genus Pestivirus within the family Flaviridae (Becher et al. 2003. Virology 311: 96-104). The 12.5 kb CSFV genome contain...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/12C07H21/04C12N15/87C12N5/10C12N7/01G01N33/573C12Q1/70
CPCA61K39/187A61K2039/5254C07K14/005C12N7/00C12N2770/24322C12N2770/24362A61K39/12G01N33/56983G01N2333/183A61K2039/543A61K2039/552C12N2770/24334C12Q1/701A61P31/14
InventorBORCA, MANUELRISATTI, GUILLERMO R.
OwnerBORCA MANUEL