Phophomannose isomerase gene and its coded protein and use

A technology of mannose phosphate and isomerase, applied in the direction of isomerase, application, genetic engineering, etc., can solve problems such as abnormal phenotype of transgenic plants, bacterial drug resistance, public health threats, etc.

Inactive Publication Date: 2008-03-12
龙域集团有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although traditional screening methods can kill non-transformed cells, these dead cells may release toxic substances and cause damage to transformed cells; a large number of dead cells will also form a barrier between transformed cells and culture, hindering the transformation of transformed cells. Nutrient uptake and their normal growth, resulting in reduced transformation rates (Joersbo, M. & Okkels, F.T. 1996. Plant Cell Rep 16:219-221); antibiotic and herbicide based screening systems will also; non-transformed cells often also occur The escape phenomenon, false positive plants appear (Girgi, M.etal.2002.Mol Breed 10:243-252; Zhang, P.& Puonti-Kaerlas, J.2000.PlantCell Rep 19:1041-1048); In addition, using Antibiotics and herbicides can sometimes cause abnormal phenotypes of transgenic plants, pollute the natural environment, and even endanger human health
The use of herbicide-resistant genes may lead to the emergence of herbicide-resistant weeds and increase the use of herbicides in the environment, causing an ecological crisis
Especially after transgenic plant cells are lysed, the resistance genes encoding antibiotics may be acquired by bacteria, leading to drug resistance of bacteria, thus posing a threat to public health

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phophomannose isomerase gene and its coded protein and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1, cloning of phosphomannose isomerase gene KL manA

[0036] Predict its phosphomannose isomerase gene sequence and design primers according to the genome sequence of Lactobacillus clavii, and add restriction endonuclease Xho I recognition sites at both ends of the primers. The primer sequences are as follows:

[0037] P1 (upstream primer): 5'- CTCGAGTACCATGCCACAGCTTTTCAG (underlined base is the recognition site of restriction endonuclease Xho I);

[0038] P2 (downstream primer): 5'- CTCGAG CTTGTCGATCGACAGATCATACTGTTTCTTTGATTGTG GTTC (underlined bases are restriction endonuclease Xho I recognition sites)

[0039] Using the genomic DNA of lactic acid yeast clavula as a template, under the guidance of primers P1 and P2, PCR amplification was carried out. The 50μl PCR reaction system is: 5μl 10×PCR reaction buffer, 0.5μl each of 10μM primers P1 and P2, 100ng DNA, 1μl 10mM dNTPs, 2.5U pfu DNA polymerase (Shanghai Shenergy Gaming Company), add sterile water to ...

Embodiment 2

[0040] Embodiment 2, construction is used for the carrier of screening transgenic plant

[0041] Plasmid pBS::KL manA was digested with restriction endonuclease Xho I, the 1.36 kb DNA fragment containing KL manA was recovered and purified, and inserted into the Agrobacterium binary vector pCAMIBA1300 (Genbank In Accession No.AF234296), the recombinant vector was transformed into Escherichia coli DH5α competent cells, positive clones were screened, plasmids were extracted, and the positive clone plasmids containing KLmanA were named pC1300 (KLmanA), and its physical map is shown in Figure 1. In this vector, KL manA is regulated by the plant gene expression element CaMV 35S enhanced promoter and CaMV 35S polyA tailing signal, which can be effectively expressed in plant cells. In addition, the plasmid also contains multiple cloning sites and its E. coli lacZ The expression box facilitates the cloning of foreign genes.

Embodiment 3

[0042] Embodiment 3, the screening of gusA transgenic tall fescue grass

[0043] 1. Construction of a transgenic plant screening vector containing gusA (target gene)

[0044] Plasmid vector pBI121 (Genbank AccessionNo.AF485783) was digested with restriction endonucleases EcoR I and Hind III, a 3kb DNA fragment containing the complete gusA expression kit was recovered and purified, and inserted into On the special screening vector pC1300 (KLmanA) constructed in Example 2, the recombinant vector was transformed into Escherichia coli DH5α competent cells, positive clones were screened, plasmids were extracted, and the positive clone plasmids containing the complete gusA expression kit were named pC1300 (KLmanA) ::gus, its physical map is shown in Figure 2.

[0045] 2. Screening of gusA transgenic tall fescue grass

[0046] The plasmid pC1300(KLmanA)::gus was transformed into Agrobacterium LBA4404 by the freeze-thaw method to obtain the Agrobacterium containing the plasmid, whic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to view more

Abstract

The invention discloses a gene and its protein of phosphomannose isomerase, and its application. The purpose is that providing a gene and its protein of phoshomannose isomerase, and applying the gene and protein in selecting trans-genic plant. The gene has one of nucleotide sequences as follow: 1) the SEQ ID NO: 1 DNA sequence in sequence table; 2) coding the DNA sequence of SEQ ID NO: 2 in the sequence table; 3) the nucleotide sequence that can hybrid with restrict DNA sequence of SEQ ID NO: 1 in the sequence table at high strict condition. Mannose has no harm for human and animal, degradation-liable in environment and selected marker system has the advantages of product yield safety, the selecting regent price is cheap, the selecting procedure is simplicity and the selected marker system don't impact the metabolism balance of transformation plant, the trans-genic plant grow vigorous, significance effect selection. The selected marker system has potential and extensive application outlook in trans-genic plant study and its market process; it may be the leading selected marker system in plant transformation.

Description

technical field [0001] The present invention relates to a selection marker gene and its coded protein and its application, in particular to a phosphomannose isomerase gene and its coded protein and its application in screening transgenic plants. Background technique [0002] In plant genetic engineering operations, the screening of transgenic plants is a crucial link. At present, genes resistant to certain toxic substances (such as antibiotics, herbicides, etc.) are generally used as selection markers to screen transgenic plants, that is, adding toxic substances to the medium can kill untransformed plant cells. Although transgenic plants can be effectively screened by this method, it also has great defects. As we all know, in the gene transformation operation, only a very small part of the cells are transformed to obtain exogenous DNA fragments, and most of the cells are still in a non-transformed state and need to be selectively removed. Although traditional screening met...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/61C12N9/90C12N15/82C12N15/65A01H4/00
Inventor 陈蕾徐建勇
Owner 龙域集团有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products