Phophomannose isomerase gene and its coded protein and use
A technology of mannose phosphate and isomerase, applied in the direction of isomerase, application, genetic engineering, etc., can solve problems such as ecological crisis, endangering human health, and natural environment pollution
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1, cloning of phosphomannose isomerase gene KL manA
[0036] Predict its phosphomannose isomerase gene sequence and design primers according to the genome sequence of Lactobacillus clavii, and add restriction endonuclease Xho I recognition sites at both ends of the primers. The primer sequences are as follows:
[0037] P1 (upstream primer): 5'- CTCGAG TACCATGCCACAGCTTTTCAG (underlined base is the recognition site of restriction endonuclease Xho I);
[0038] P2 (downstream primer): 5'- CTCGAG CTTGTCGATCGACAGATCATACTGTTTCTTTGATTGTG GTTC (underlined bases are restriction endonuclease Xho I recognition sites)
[0039] Using the genomic DNA of lactic acid yeast clavula as a template, under the guidance of primers P1 and P2, PCR amplification was carried out. The 50μl PCR reaction system is: 5μl 10×PCR reaction buffer, 0.5μl each of 10μM primers P1 and P2, 100ng DNA, 1μl 10mM dNTPs, 2.5U pfu DNA polymerase (Shanghai Shenergy Gaming Company), add sterile water to...
Embodiment 2
[0040] Embodiment 2, construction is used for the carrier of screening transgenic plant
[0041] Plasmid pBS::KL manA was digested with restriction endonuclease Xho I, and the 1.36 kb DNA fragment containing KL manA was recovered and purified, and inserted into the Agrobacterium binary vector pCAMIBA1300 (Genbank Accession No.AF234296), the recombinant vector was transformed into Escherichia coli DH5α competent cells, the positive clones were screened, and the plasmid was extracted. The positive clone plasmid containing KL manA was named pC1300(KLmanA), and its physical map is as follows: figure 1 As shown, in this vector, KL manA is regulated by the plant gene expression element CaMV 35S enhanced promoter and CaMV 35S polyA tailing signal, and can be effectively expressed in plant cells. In addition, the plasmid also contains multiple cloning sites and Its Escherichia coli lacZ expression box facilitates the cloning of foreign genes.
Embodiment 3
[0042] Embodiment 3, the screening of gusA transgenic tall fescue grass
[0043] 1. Construction of a transgenic plant screening vector containing gusA (target gene)
[0044] The plasmid vector pBI121 (Genbank AccessionNo.AF485783) was digested with restriction endonucleases EcoRI and Hind III, the 3kb DNA fragment containing the complete gusA expression kit was recovered and purified, and inserted into the On the special screening vector pC1300 (KLmanA) constructed in Example 2, the recombinant vector was transformed into Escherichia coli DH5α competent cells, positive clones were screened, plasmids were extracted, and the positive clone plasmids containing the complete gusA expression kit were named pC1300 (KLmanA)∷ gus, its physical map is as follows figure 2 shown.
[0045] 2. Screening of gusA transgenic tall fescue grass
[0046] The plasmid pC1300(KLmanA)::gus was transformed into Agrobacterium LBA4404 by the freeze-thaw method to obtain the Agrobacterium containing...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 