Unlock instant, AI-driven research and patent intelligence for your innovation.

Polynucleotide sequence for detecting matrix metal proteinase activity

An active and fluorescent protein technology, which is applied in the determination/inspection of microorganisms, the introduction of foreign genetic material using carriers, fluorescence/phosphorescence, etc., which can solve the problems of difficult synthesis steps, inaccessibility, and high cost.

Inactive Publication Date: 2009-11-04
HUAZHONG UNIV OF SCI & TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the high heterogeneity and complexity of tumors, exogenous molecular probes are easily affected by local microcirculation and distributed unevenly in tumor tissues, and even cannot reach them due to poor local blood supply.
In addition, the preparation of this type of molecular probe requires fresh artificially synthesized short peptide molecules every time, which is difficult and costly.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polynucleotide sequence for detecting matrix metal proteinase activity
  • Polynucleotide sequence for detecting matrix metal proteinase activity
  • Polynucleotide sequence for detecting matrix metal proteinase activity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of Genotype Molecular Probes for Detection of Matrix Metalloproteinase Activity

[0031] From pECFP-C1, pEYFP-C1 plasmids (purchased from Clontech, USA), utilize the following primer pair, respectively clone CFP, YFP nucleotide sequence by conventional PCR technique, and adopt nested PCR method to CFPPCR primer from 5' end The amino acid sequence introduced is LEGGIPVSLRSG (SEQ ID NO.: 6) linker peptide nucleotide sequence,

[0032] Forward primer for EYFP:

[0033] 5'-GA AGATCT ATGGTGAGCAAGGGCGAGGAGCTGTTCAC-3' (the underline is the BglII restriction site) (SEQ ID NO.: 1)

[0034] Reverse primer for EYFP:

[0035] 5'-CG CTCGAG CTTGTACAGCTCGTCCATGCCGAGA-3' (the underline is the XhoI restriction site) (SEQ ID NO.: 2)

[0036] ECFP was amplified twice using two forward primers,

[0037] Forward primer 1:

[0038] 5'CTCTTAGATCCGGAATGGTGAGCAAGGGCGAGGAGC3' (SEQ ID NO.: 3)

[0039] Forward primer 2:

[0040] 5'-CCGCTCGAGGGTGGAATTCCCGTGTCTCTTAGAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a polynucleotide sequence for detecting matrix metalloproteinase activity, which comprises: a nucleotide sequence encoding a donor fluorescent protein; a nucleotide sequence encoding an acceptor fluorescent protein; and a encoding peptide linker Nucleotide sequence; the peptide linker connects the donor fluorescent protein and the acceptor fluorescent protein; the peptide linker is a peptide linker specifically recognized by members of the matrix metalloproteinase family. The polynucleotide sequence is suitable for monitoring matrix metalloproteinase activity and screening matrix metalloproteinase inhibitors at the level of in vitro and living cells.

Description

technical field [0001] The present invention relates to a genotype molecular probe based on fluorescent protein, more specifically, the present invention relates to a polynucleotide sequence for detecting matrix metalloproteinase activity, an expression vector comprising the polynucleotide sequence, and the polynucleotide sequence The use of and the method for detecting the enzyme activity in vivo. Background technique [0002] Invasion and metastasis are notable features of malignant tumors, and the degradation of tumor extracellular matrix (ECM) is one of the key steps in tumor invasion and metastasis. Matrix metalloproteinases (matrix metalloproteinases, MMPs) are important enzymes involved in the degradation of extracellular matrix. Studies have shown that the invasion and metastasis of tumor cells are closely related to the level of production or induction of matrix metalloproteinase expression. Matrix metalloproteinases are a large family named for their need for Ca+...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/37C12N15/11C12N15/62C12N15/63C07K19/00G01N21/64
Inventor 骆清铭张智红杨杰曾绍群
Owner HUAZHONG UNIV OF SCI & TECH