Recombination adenovirus for expressing human particle cytolysin and its preparing method and use

A technology of recombinant adenovirus and granulysin, applied in the field of gene therapy, can solve the problems of difficult to reach the target site of treatment, high treatment cost and high cost

Inactive Publication Date: 2007-09-12
华中科技大学同济医学院
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] At present, the application of granulysin in clinical treatment has the following obstacles: 1. The high cost of preparation leads to high treatment costs; 2. It cannot enter the cell to kill intracellular pathogens; 3. It is difficult to reach the target site of treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombination adenovirus for expressing human particle cytolysin and its preparing method and use
  • Recombination adenovirus for expressing human particle cytolysin and its preparing method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1. Cloning of human granulysin gene

[0031] Referring to the GenBank granulysin cDNA sequence, the structural sequence of the 419th to 640th nucleotide sequence was taken to artificially synthesize the gene fragment, and the synthesized gene fragment was cloned into the vector pUC57 and confirmed by sequencing. Entrust Shanghai Biological Engineering Company to complete. The gene sequence of the granulysin is as follows (sequence listing sequence 3):

[0032] 5'GGCCGTGACTACAGGACCTGTCTGACGATAGTCCAAAAACTGAAGAAGATGGTG

[0033] GATAAGCCCACCCAGAGAAGTGTTTCCAATGCTGCGACCCGGGTGTGTAGGACGGG

[0034] GAGGTCACGATGGCGCGACGTCTGCAGAAATTTCATGAGGAGGTATCAGTCTAGAG

[0035] TTACCCAGGGCCTCGTGGCCGGAGAAACTGCCCAGCAGATCTGTGAGGACCTCAG

[0036] G3'.

Embodiment 2

[0037] Example 2. Construction of an adenoviral vector expressing human granulysin

[0038] The primers for amplifying the human granulysin gene fragment were designed. The upstream primer contained the start code XhoI and ATG, and the downstream primer contained the TAA termination code and HindIII. The target gene was amplified by PCR method and cloned into the pZero-T vector (completed by Beijing Baosai Biological Company). After the enzyme digestion identification was confirmed, the sequence was determined. See sequence 1 for the gene sequence of the cloned and expressed granulysin. The corresponding amino acid sequence of the expression product is shown in sequence 2 of the sequence listing.

[0039] After XhoI and HindIII digestion and recovery of specific fragments, it was subcloned into the corresponding restriction site of the adenovirus transfer vector pShuttle-CMV (provided by Qbiogene, 6.6 kb), confirmed by restriction digestion and named pShullte-CMV-GRA. pShul...

Embodiment 3

[0040] Example 3. Preparation, amplification and titer detection of recombinant adenovirus expressing human granulysin (see Figure 2: production process flow chart)

[0041] 20 μg of recombinant adenovirus plasmid was digested with PacI, extracted with conventional phenol, chloroform / isoamyl alcohol, washed with ethanol, resuspended in 50ul TE under sterile conditions, and transfected into -293 cells according to the calcium phosphate method in the manual to obtain human-expressing particles Lysin recombinant adenovirus rAd5-GRA (see Figure 1: Schematic diagram of the structure of recombinant human granulysin adenovirus).

[0042] The recombinant adenovirus rAd5-GRA is used as an active ingredient to prepare nasal drops, sprays, injections and oral preparations according to conventional medical methods.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kind of recombinant adenovirus expressing human granulysin, which genome is deleted E1 and E3, and inserted the expression cassette of human granulysin in E1, and the expression cassette includes: promoter sequence, human granulysin coding sequence and polyadenylation signal by turns. The adenovirus type is Ad5. The preparation method includes: a. cloning the gene of human granulysin, b. constructing the plasmid pAd-GRA expressing human adenovirus, c. digesting pAd-GRA with enzyme PacI, conventionally extracting with phenol, chloroform / isoamyl alcohol, washing with ethanol, suspending in TE 50 mu l under sterile conditions, and transferring -293 cells.

Description

technical field [0001] The invention relates to the field of gene therapy, in particular to a recombinant adenovirus expressing human granulysin, a preparation method thereof, and various pharmaceutical compositions containing the recombinant adenovirus. Background technique [0002] Granulysin (Granulysin, or 519 gene, Granulysin) is a protein located in the cytoplasmic granules of killer T cells (CTL) and natural killer cells (NK), and belongs to the SAPLIP (saposin-like protein) family member one [ Pena SV, et al. Semin Immunol, 1997, 9(2): 117-125 ] . During the body's immune response, granulysin, together with perforin, granzyme and other granule molecules, is excreted out of the cell, and participates in the immune process of antibacterial, antiviral and tumor cell killing. [0003] Exogenous stimulation first acts on TCR on the surface of CTL, and TCR transmits signals. Granlysin is translocated with intracellular granules to the contact site between CTL and target...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/01C12N15/12C07K14/435A61K39/235
Inventor范雄林高倩
Owner华中科技大学同济医学院