Recombined protein carrier PEA II-HphA of actively carrying exogenic gene, its preparing method and use

A technology for exogenous genes and recombinant proteins, which can be used in recombinant DNA technology, botanical equipment and methods, biochemical equipment and methods, etc., and can solve the problems of short expression time, short expression time, and unclearness of non-viral transfer systems.

Inactive Publication Date: 2007-11-14
MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Antisense drugs are easily degraded by endogenous nucleases, so their stability is not high, which is an important defect affecting their application
[0017] Non-viral gene therapy has been developed for more than ten years, and some achievements have been made, but there are still some problems: (1) How does the vector carry DNA into the cell? How does DNA enter the nucleus and play a role in the specific process? How the drug protein is expressed and how the gene is turned off is still not well understood
(2) The non-viral transfer system faces the problems of short expression time and low expression efficiency
(3) Although safety is a major advantage of non-viral gene therapy, its disadvantages such as non-targeting, short expression time, low expression efficiency, limited overall application, and the safety of long-term application need further investigation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined protein carrier PEA II-HphA of actively carrying exogenic gene, its preparing method and use
  • Recombined protein carrier PEA II-HphA of actively carrying exogenic gene, its preparing method and use
  • Recombined protein carrier PEA II-HphA of actively carrying exogenic gene, its preparing method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1: Gene amplification in PEAIa region and region II and ligation with pET26b vector

[0061] The sequences of PEAIa and II regions were searched through GenBank, and amplification primers were designed for them. The upstream primer was marked as P1, and the downstream primer was marked as P2. The NdeI restriction site and the EcoRI restriction site were introduced into the N-terminus of the Ia region and the II region fragment and the C-terminus. pCDPT 2 (Containing PEA whole gene sequence) as template, P1 and P2 are primers to carry out amplification reaction, and the obtained PCR product is marked as PEAIa+II;

[0062] P1 (28bp): 5'GGAATTCCATATGGCCGAGGAAGCCTTC 3' with NdeI restriction site

[0063] P2 (23bp): 5'CGGAATTCCGCGCCGGCCTCGTC 3' with EcoRI restriction site

[0064] Due to the high GC content of the gene sequences in PEAIa and II regions, LaTaq enzyme was selected for PCR reaction, and the gene fragments obtained by PCR amplification were analyzed b...

Embodiment 2

[0066] Example 2: Ligation of recombinant plasmid pET26b-PEA Ia+II to HPhA

[0067] The entire gene sequence of Pyrococcus horikoshii OT3 has been determined, which contains the histone gene PHS051. According to the sequence of the gene, two primers with restriction sites are designed to amplify the target gene; the upstream primer is labeled P3, and the downstream primer is labeled is P4; and an EcoR I restriction site and a HindIII restriction site are introduced at the N-terminus of HPhA and the C-terminus of HPhA; the plasmid pET11a-HPhA is used as the template, and P3 and P4 are used as primers to carry out the amplification reaction, and the obtained PCR product is marked as HPhA ;

[0068] P3 (26bp): 5'CGGAATTCGTGTGGATGATGGGAGAA 3' contains EcoR I restriction site

[0069] P4 (28bp): 5'CCCAAGCTTTCAAGCTCTTAATAGCGAGC 3' with HindIII restriction site

[0070] Amplify the gene fragment of HPhA by conventional PCR method, and analyze it by agarose gel electrophoresis.

[...

Embodiment 3

[0072] Example 3: SDS-PAGE results and immunoblotting analysis of recombinant protein PEAIa+II-HPhA expression products

[0073] The recombinant plasmid pET26b-PEAIa+II-HPhA was transformed into the expression bacteria-Escherichia coli BL21-Codon Plus, after induction by IPTG, the SDS-PAGE results showed that the recombinant protein PEA-HPhA has an obvious expression band at about 48.98KD. Values ​​are consistent; see Figure 6;

[0074] The lysate supernatant and precipitate of recombinant protein expressing bacteria were subjected to SDS-PAGE electrophoresis at the same time. The results showed that most of the target protein was in the supernatant, and a small amount of target protein also existed in the corresponding position in the precipitate. It can be expressed in a soluble form under an inducing environment.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention openly carrying a foreign gene active recombinant protein carrier core area PEAII-HphA and preparation methods and application, but also take the initiative to open a foreign gene carrying the recombinant protein carrier core gene fragment PEAII-HphA ; The initiative delivery exogenous gene's reorganization protein carrier is by guidance member - PEA toxin cross membrane indexing area PEAII- ultra is addicted to the hot Archaea histone HphA composition protein; Under the guidance member's guidance, on the carrier and the target cell's acceptor specificity union has manifested its target tropism, lies between in the acceptor leads passes PEA IIThe cross membrane transportation enters in cell's to swallow the function traversing cell membrane on own initiative, has manifested its initiative, raised the gene transportation efficiency effectively . HphA combination of DNA, and a strong ability with the exogenous gene complexes formed in the active transport carrier in the process, arrived at the exogenous gene, increasing its expression efficiency, cell non-toxic, more secure; Superior to the traditional vector and liposomes,it can be widely used in gene therapy and transgenic animal research.

Description

technical field [0001] The present invention relates to a recombinant protein carrier for actively carrying exogenous genes, its preparation method and the use of medicines. Background technique [0002] Gene therapy is a new disease treatment model developed in the 1990s. Its definition is relatively broad. Broadly speaking, gene therapy is a method of applying genes or gene products to treat diseases. In a narrow sense, gene therapy is a treatment method that transfers normal genes or therapeutic genes from the outside world to target cells of the human body through vectors for gene modification and expression, and improves diseases. Gene therapy is a fundamental treatment. It can achieve the purpose of treatment by replacing mutated disease-causing genes, changing the genetic structure of diseased cells, or by introducing genes to enhance the body's immunity. Compared with traditional drug treatment, the above measures are fundamentally controlling the disease. In 1990...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/31A61K48/00C12N15/85
Inventor张国利朱平吴广谋岳玉环
OwnerMILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI