cDNA order of salt algae 26s proteasome subunit RPT2 gene, its coding protein and full-length gene order and clone method

A proteasome, full-length gene technology, applied in the field of cDNA sequence, can solve the problem that the precise functions of the six RPT subunits are not very clear.

Inactive Publication Date: 2008-01-02
SHANGHAI UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] So far, the precise functions of the six RPT subunits are still not well understood

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • cDNA order of salt algae 26s proteasome subunit RPT2 gene, its coding protein and full-length gene order and clone method
  • cDNA order of salt algae 26s proteasome subunit RPT2 gene, its coding protein and full-length gene order and clone method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Cloning and Analysis of DvRPT2 Full-length Coding Region Sequence

[0028] The gene DvRPT2 cloned in this experiment was derived from the Salina EST library in our laboratory. The DvRPT2-containing Salina EST library plasmid was digested with restriction endonucleases (EcoR I / Xho I) to release the target fragment and be used in subsequent experiments. According to sequencing analysis, the longest cDNA fragment of DvRPT2 is 1534bp, which contains the specific tailing signal TGTAA and poly(A) structure of the green algae gene. The analysis results of Vector NTI software showed that the longest reading frame of DvRPT2 encoded a protein containing 446 amino acids, the molecular weight of the protein was 49.7kDa, and the isoelectric point was 5.98. It can be seen that the protein encoded by DvRPT2 is an acidic protein.

Embodiment 2

[0029] Example 2: Sequencing and splicing of DvRPT2 gene sequence

[0030] The BAC clone containing the DvRPT2 gene was obtained by screening the Salina BAC library. Using the Large-Construct Kit of QIAGEN Company to extract the BAC plasmid without Escherichia coli genome contamination, the recovered DNA was mechanically crushed, and the DNA fragments with a size of 2-4 kb were recovered and connected to the pUC18 vector to construct a shotgun library. The primer sequence of the screening library is:

[0031] RPT2P2a: 5′ CCCTGTGAGACTGACTTGAGA 3′

[0032] RPT2P2b: 5' AGCTTGCACTTGGCTGTG 3'

[0033] Large-throughput extraction of plasmid DNA from the shotgun library was performed on the MegaBACE 4500 for sequence determination. Each shotgun plasmid is sequenced bidirectionally using M13 forward and reverse primers. A total of 384 shotgun library plasmids, namely four 96-well plates, were sequenced.

[0034]In the parallel computer group of the RedHat Linux platform, the meas...

Embodiment 3

[0035] Example 3: Expression of DvRPT2 induced by different salt concentrations and 3M salt

[0036] For the study of DvRPT2 at different steady-state salt concentrations, we cultured Salina cells in Salina media containing 0.5, 1M, 2M, 3M, 4M and 5M NaCl at 2×10 6 Cells were collected at the time of cell / ml, and the total RNA of Salina cells was extracted respectively. The above RNA samples were digested with DNase I, reversed into cDNA under the action of reverse transcriptase, diluted 10 times and used as templates for realtime PCR under various experimental conditions. PCR primers:

[0037] RPT2P2a: 5'-GGAGGAACGCACCAAGAT-3'

[0038] RPT2P2b: 5′-CAGGATGCCAACAACAGAGT-3′

[0039] DvActinRT+: 5′-GCCACTGCTTTAGCTGTTTGC-3′

[0040] DvActinRT-: 5′-CCTCATGCTCCCAGATGTTCTA-3′

[0041] After the library plasmids of DvRPT2 and DvACTIN were purified and quantified, the 10-fold serial dilution was used as the standard curve of quantitative PCR, and the transcription amount of DvACTI...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a cDNA sequence, a coding protein, a full-length gene sequence and the clone method of a 26S proteinase body subunit RPT2 gene (DvRPT2)in Dunaliella viridis. The uplift expression of 26S proteinase body subunit RPT2 gene in Dunaliella viridis enhances the hydrolytic efficient of TP, accelerates that the substrate protein enters the active position of the proteinase body, reduces the abnormal protein content in the cell, and improves the salt resistance of Dunaliella viridis, so the research about Dunaliella viridis RPT2 subunit indicates the protein degradation pathway of 26S proteinase body, the salt endurance mechanism and the salt-resistance plant improvement, which has the finite theoretical and actual application value.

Description

technical field [0001] The invention relates to a cDNA sequence of a 26S proteasome subunit RPT2 gene (DvRPT2) in Dunaliella viridis, its coded protein, a full-length gene sequence and a cloning method. Background technique [0002] Salina, also known as Dunaliella, is a single-celled eukaryotic green algae without cell walls, and is the most salt-tolerant eukaryote known. At the same time, it can also tolerate stresses caused by changes in light, environmental pH, and temperature. Therefore, it is widely used to study the response mechanism of plants to various stresses, especially the mechanism of salt tolerance. [0003] The ubiquitin / 26S proteasome pathway (ubiquitin / 26S proteasome pathway) is a very important mechanism in the selective degradation of proteins in eukaryotic cells. Due to its efficient ability to degrade intracellular proteins, it participates in various aspects of eukaryotic cell regulation. The six ATPase subunits of the 26S proteasome contain AAA-AT...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/57C12N9/50C07K14/405
Inventor宋任涛许政暟孙晓斌孟祥宗
OwnerSHANGHAI UNIV