Check patentability & draft patents in minutes with Patsnap Eureka AI!

Papillomavirus detection and parting method as well as liquid phase chip thereof

A virus detection, liquid phase chip technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of poor signal-to-noise ratio of detection results, increase coating steps, low fluorescence signal, etc., and achieve improved sensitivity , Increased fluorescence signal value, overcome the effect of low sensitivity

Inactive Publication Date: 2008-08-27
SUREXAM BIO TECH
View PDF2 Cites 30 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the need to coat specific oligonucleotide probes on the microspheres, the coating step is increased, and the coated microspheres can only be used for papillomavirus HPV typing
In addition, the existing HPV detection liquid chip technology adopts the method of labeling biotin at the 5' end during PCR amplification, so the fluorescence signal is relatively low, which limits the sensitivity of detection
At the same time, after PCR amplification, the redundant free nucleotides (such as biotin-labeled primers and dNTPs) in the system were not processed, which made the subsequent hybridization reaction more likely to be non-specific, thus making the signal noise of the detection results Comparison

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Papillomavirus detection and parting method as well as liquid phase chip thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1 human papillomavirus HPV detection and typing liquid phase chip kit mainly includes:

[0027] 1. Specific primer sequence (ASPE primer)

[0028]For 22 types of HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 70, 73, 82, 06, 11, 42, 43, 44 Design specific primer sequences (18-22bp), add a 24bp specific tag tag sequence to the 5' end of the primers, and these tag tag sequences can specifically complement each other with the corresponding anti-tag sequences on the microspheres. The ASPE sequence is shown in the table below:

[0029] Table 1 ASPE primer sequences

[0030] SEQ NO.

type

NCBI serial number

Sequence(5'→3')

1

HPV06

X00203

AATCTACAAATCCAATAATCTCATTCCGTAACTACATCTTCCA

2

HPV11

M14119

CAATTCAAATCACAATAATCAATCTCTGTGTCTAAATCTGCTAC

3

HPV16

K02718

CAATTCATTTCATTCACAATCAATTACCCTACGACATGGGGAG

4

HPV18

X05015

TCAACAATCTTTTACAATCAAATCTGCTT...

Embodiment 2

[0045] Example 2 Detection and typing of clinical samples using HPV detection and typing liquid chip

[0046] The formula of described various solutions is as follows:

[0047] 50mM MES buffer (pH5.0) formula (250ml):

[0048] Reagent

source

Final concentration

Dosage per 250ml

MES

(2[N-Morpholino]

ethanesulfonic

acid)

Sigma M-2933

0.05M

2.44g

5MNaOH

Fisher SS256-500

---

5 drops

[0049] 2×Tm hybridization buffer

[0050] Reagent

source

Final concentration

Dosage per 250ml

[0051] 1M Tris-HCl, pH8.0

SigmaT3038

0.2M

50ml

5M NaCl

Sigma S5150

0.4M

20ml

Triton X-100

Sigma T8787

0.16%

0.4ml

[0052] Store at 4°C after filtration

[0053] Biotin-labeled dNTPs were purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses papillomavirus detection and a typing liquid chip, and a process which is used to the detection and typing papillomavirus. The liquid chip mainly comprises microsphere which is respectively enveloped with specific anti-tag label sequence and 7-10 T spacer arm sequence which is arranged between anti-tag label sequence and microsphere, wherein anti-tag label sequence is chosen from two or more than two sequences in SEQ ID NO. 25- SEQ ID NO.47, specific ASPE primer is respectively designed aiming at each typing HPV, ASPE primer is chosen from two or more than two sequence from SEQ ID NO.1-SEQ ID NO.23, and primer of target sequence which has mutant sites is amplified. The liquid chip improves the current liquid chip technology, which makes ribonucleotide probe microspheres which is prepared be suitable to different detection projects, largely increases fluorescent signal value which is detected, thereby further increasing sensitivity of the detection, strengthening signal-to-noise ratio, and making detection results more accurate and reliable.

Description

technical field [0001] The invention relates to medical in vitro diagnostic technology, in particular to a method for detecting and typing human papillomavirus and a liquid phase chip thereof. Background technique [0002] Human papilloma virus (HPV) is a small-molecule circular double-stranded DNA virus that spreads widely among people through sexual contact, direct or indirect contact with contaminated objects, and specifically infects human skin and mucous membranes. Squamous epithelial cells can cause a variety of benign or malignant lesions, which seriously threaten human health. According to the sequence variation of HPV gene, it can be divided into many types. There are more than 100 types of HPV identified so far, about 40 of which can infect human reproductive organs, and about 20 are related to tumors. According to the risk of different types of HPV and tumor occurrence, it is divided into high-risk type and low-risk type. Low-risk HPV types such as HPV6, 11, 40,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 许嘉森林一群杨惠夷
Owner SUREXAM BIO TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More