Genetic engineering target glioma Acp-W1 resistant protein, preparation method and application

A glioma and protein technology, applied in genetic engineering, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problems of low content of active ingredients, difficult to separate, complex components, etc., to achieve inhibition of malignant proliferation and The effects of transfer, drug effect, and high protein production

Inactive Publication Date: 2011-04-20
WUHAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, its components are quite complex, and the structure and physical and chemical properties of the components are similar, so it is difficult to separate them. Many components have even opposite effects, and the active components are often low in content. These undoubtedly limit the research and application of scorpion venom.
In particular, Chlorotoxin is only a small peptide of 36 amino acids, and its content in scorpion venom is very low. The yield and cost of separating and purifying Chlorotoxin from the scorpion venom mixture are low and expensive, which severely limits the anti-neurocyte activity of Chlorotoxin. Research and development of tumor drugs
Although a large amount of protein can be produced by using genetic engineering technology, Chlorotoxin is only composed of 36 amino acids, which is a small protein polypeptide. If the method of genetic engineering is used to produce recombinant Chlorotoxin, then Chlorotoxin will be expressed in receptor expression bacteria. It is easy to be degraded by protease, and the expression level of such a small protein is not high and it is difficult to purify later

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering target glioma Acp-W1 resistant protein, preparation method and application
  • Genetic engineering target glioma Acp-W1 resistant protein, preparation method and application
  • Genetic engineering target glioma Acp-W1 resistant protein, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Molecular design of W1 gene

[0036] Based on the reported amino acid sequence of Chlorotoxin (protein accession number: P45639), the nucleotide sequence encoding the protein was deduced using conventional methods, while considering the codon bias of Escherichia coli. On this basis, primers were designed for PCR amplification to obtain the target gene W1. 正向引物为P1:5’GCCGGATCCGATGACGATGACAAAATGTGTATGCCGTGCTTCACTACC3’,引物P2:5’CAATCGTCACATTTACGTGCCATCTGGTGATCGGTAGTGAAGCACGGCAT3’;反向引物为P3:5’CGTAAATGTGACGATTGCTGTGGTGGCAAAGGTCGTGGTAAATGCTACCG3’,引物P4:5’GCCCTCGAGTCAACGGCACAGACAACGCGGACCGTAGCATTTACCACGAC3’。 Primer P2 and primer P3 are used for the first round of PCR amplification, and primer P1 and primer P4 are used for the second round of PCR amplification. The reagents for the first round of PCR reaction are as follows: mix 5 μl of 10xTaq polymerase buffer, 4 μl of dNTP mix, 1 μl of primer P2, 1 μl of primer P3, 0.25 μl of Taq DNA polymerase and 37.75 Mix in microlit...

Embodiment 2

[0037] Embodiment 2: Construction of Acp-W1 protein recombinant expression vector

[0038] A: Double digestion and ligation of W1 and pGEX-6p-1

[0039] The PCR product obtained in Example 1 was extracted with phenol:chloroform:isoamyl alcohol (25:24:1), precipitated with absolute ethanol (2.5 volumes), and then dissolved with 50 μl of sterilized water. The recovered PCR product and expression vector pGEX-6p-1 plasmid were digested with restriction endonucleases BamHI and XhoI (products of Takara Company). Enzyme digestion reaction: 1 μl each of BamHI (14U / μl) and XhoI (20U / μl), 2.5μl of 10-fold buffer, 50-100ng of PCR product or pGEX-6p-1 plasmid, add sterile water to a total volume of 25μl . 37C water bath for 5 hours, the digested product was extracted with phenol: chloroform: isoamyl alcohol, precipitated with absolute ethanol (2.5 volumes) and washed with T 4 The PCR product was ligated with the expression vector pGEX-6p-1 with DNA ligase (product of Takara Company). ...

Embodiment 3

[0046] Embodiment 3: the preparation of recombinant Acp-W1 genetically engineered bacteria

[0047] The positive clones sequenced correctly in step 2C of Example 2 were extracted by the alkaline lysis method to extract the recombinant expression plasmid pGEX-Acp-W1 (see the second edition of "Molecular Cloning" for the method). The extracted pGEX-Acp-W1 plasmid was transformed into Escherichia coli competent Rossetta (DE3) cells prepared in the step of Example 2B according to the transformation method in the step of Example 2C. Tablet for LB / AP + Agar plates. A single clone was picked to obtain the genetically engineered strain Rossetta (DE3) (pGEX-Acp-W1).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The present invention discloses a gene-engineered targeting anti-glioma Acp-W1 protein, a preparation method and applications. The present invention separates out a protein, the sequence of which is an amino acid sequence shown as SEQ ID No: 1. Primers related to genetic engineering insert the nucleotide sequence of chlorotoxin into an expression vector pGEX-6p-1, so that a recombinant expressionplasmid is formed; the recombinant expression plasmid transforms colon bacillus Rossetta (DE3), and after cell lysis, the Acp-W1 protein is produced by affinity chromatography, ultrafiltration, desalination and chromatography purification. The Acp-W1 protein has specific targeting effect on gliomas, can effectively inhibit the proliferation of rat gliomas and has targeting anti-glioma effect. TheAcp-W1 protein is applicable to the preparation of drugs treating or preventing gliomas. The preparation method of the present invention has the advantages of simplicity, convenient operation, high output and good biological activity.

Description

technical field [0001] The invention belongs to the field of biotechnology. The invention relates to a gene engineering targeting anti-glioma Acp-W1 protein, and also relates to a preparation method for targeting anti-glioma Acp-W1 protein recombination, and also relates to the genetic engineering The use of the protein Acp-W1, the targeted anti-glioma protein produced by genetic engineering can efficiently inhibit the proliferation and metastasis of glioma at the animal model level, and has the application value of being developed into an anti-glioma drug. Background technique [0002] Brain glioma is the most common tumor of the central nervous system, its incidence rate accounts for about 40% of all intracranial tumors, and the average survival time of patients is one year. The efficacy and application potential of all current treatment measures (such as: surgical resection, chemotherapy, radiotherapy and immunotherapy, etc.) are extremely limited. In view of this grim s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/70A61K38/17A61P35/00
Inventor李文鑫孙正博曹志贱蒋达和范少忠刘辉
OwnerWUHAN UNIV