Test paper strip for rapidly detecting swine streptococcicosis type 2 colloidal gold
A technology for streptococcus suis and test strips, which is applied in measuring devices, instruments, scientific instruments, etc., to save manpower and material resources, control the epidemic situation in time, and make the results clear and easy to identify.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Cloning expression of embodiment 1 Streptococcus suis type 2 specific antigen MRP
[0030] (1) Amplification of MRP gene
[0031] PCR primer design
[0032] According to the MRP nucleotide sequence (GenBank accession number is EF520110), a pair of primers were designed, and Sac I and Hind III restriction sites and protective bases were added to the two ends of the primers respectively. Primers P1 and P2 can amplify Streptococcus suis 2 Type MRP gene open reading frame (ORF) 298 ~ 827bp 529bp fragment. The primer sequences are:
[0033] Upstream primer P1: 5'GTAGAGCTCGAACAGGTAACATCAGA3';
[0034] Downstream primer P2: 5'CAGAAGCTTAAGAGTAACGAATGTAGG3'.
[0035] PCR amplification
[0036] Each reactant was sequentially added in the following order and conditions and PCR amplification was performed. Template DNA 2μL, 10×buffer 10μL, 25mmol / L MgCl 2 8 μL, 215 mmol / L dNTPs 8 μL, primers P1 and P2 (0.1 μmol / L) each 1 μL, ddH 2 O 68 μL, Taq enzyme (5UP μL) 3 μL. The am...
Embodiment 2
[0047] Embodiment 2: Preparation of MRP polyclonal antibody
[0048] (1) Animal immunity:
[0049] Select 1-2kg New Zealand white rabbits, inject MRP protein subcutaneously in multiple points on the back, and the immune dose is 1mg / kg. A total of 4 times of immunization.
[0050] (2) Immunological titer detection:
[0051] ELISA plate coated with MRP protein, 4μg per well. The titer of immune serum was detected by indirect ELISA method. When the serum titer reaches 1:20000 or more, serum can be collected.
[0052] (3) Antibody purification and verification:
[0053] Purification by conventional octanoic acid method. The purity was tested by non-denaturing PAGE electrophoresis, showing a protein band. The activity is tested by ELISA, and the titer is greater than 1:20000.
Embodiment 3
[0054] Embodiment 3: the development of the rapid detection test strip of Streptococcus suis type 2 antibody (referring to Fig. 1)
[0055] (1) Preparation of colloidal gold-MRP conjugates:
[0056] It was determined by experiments that the optimum binding pH value of MRP antigen colloidal labeling was 8.0, and the ratio of colloidal gold and antigen was 50 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), take the colloidal gold-MRP conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb on the glass fiber, and freeze-dry , and stored in a dry environment.
[0057] (2) Coating antigen on nitrocellulose membrane:
[0058] MRP was diluted to 3.5 mg / ml with 0.01M PBS. Anti-MRP polyclonal antibody was diluted to 2mg / ml with 0.01M PBS. Spray the two on the nitrocellulose membrane at a speed of 1 μl / cm with a film spraying machine to form a test line and a control line, respectively. ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com