Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Test paper strip for rapidly detecting swine streptococcicosis type 2 colloidal gold

A technology for streptococcus suis and test strips, which is applied in measuring devices, instruments, scientific instruments, etc., to save manpower and material resources, control the epidemic situation in time, and make the results clear and easy to identify.

Inactive Publication Date: 2009-02-11
BEIJING ZHUANGDI HAOHE BIOMEDICINE SCI & TECH
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] However, there is still no convenient, quick and specific detection method that can specifically detect Streptococcus suis type 2

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper strip for rapidly detecting swine streptococcicosis type 2 colloidal gold
  • Test paper strip for rapidly detecting swine streptococcicosis type 2 colloidal gold
  • Test paper strip for rapidly detecting swine streptococcicosis type 2 colloidal gold

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Cloning expression of embodiment 1 Streptococcus suis type 2 specific antigen MRP

[0030] (1) Amplification of MRP gene

[0031] PCR primer design

[0032] According to the MRP nucleotide sequence (GenBank accession number is EF520110), a pair of primers were designed, and Sac I and Hind III restriction sites and protective bases were added to the two ends of the primers respectively. Primers P1 and P2 can amplify Streptococcus suis 2 Type MRP gene open reading frame (ORF) 298 ~ 827bp 529bp fragment. The primer sequences are:

[0033] Upstream primer P1: 5'GTAGAGCTCGAACAGGTAACATCAGA3';

[0034] Downstream primer P2: 5'CAGAAGCTTAAGAGTAACGAATGTAGG3'.

[0035] PCR amplification

[0036] Each reactant was sequentially added in the following order and conditions and PCR amplification was performed. Template DNA 2μL, 10×buffer 10μL, 25mmol / L MgCl 2 8 μL, 215 mmol / L dNTPs 8 μL, primers P1 and P2 (0.1 μmol / L) each 1 μL, ddH 2 O 68 μL, Taq enzyme (5UP μL) 3 μL. The am...

Embodiment 2

[0047] Embodiment 2: Preparation of MRP polyclonal antibody

[0048] (1) Animal immunity:

[0049] Select 1-2kg New Zealand white rabbits, inject MRP protein subcutaneously in multiple points on the back, and the immune dose is 1mg / kg. A total of 4 times of immunization.

[0050] (2) Immunological titer detection:

[0051] ELISA plate coated with MRP protein, 4μg per well. The titer of immune serum was detected by indirect ELISA method. When the serum titer reaches 1:20000 or more, serum can be collected.

[0052] (3) Antibody purification and verification:

[0053] Purification by conventional octanoic acid method. The purity was tested by non-denaturing PAGE electrophoresis, showing a protein band. The activity is tested by ELISA, and the titer is greater than 1:20000.

Embodiment 3

[0054] Embodiment 3: the development of the rapid detection test strip of Streptococcus suis type 2 antibody (referring to Fig. 1)

[0055] (1) Preparation of colloidal gold-MRP conjugates:

[0056] It was determined by experiments that the optimum binding pH value of MRP antigen colloidal labeling was 8.0, and the ratio of colloidal gold and antigen was 50 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), take the colloidal gold-MRP conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb on the glass fiber, and freeze-dry , and stored in a dry environment.

[0057] (2) Coating antigen on nitrocellulose membrane:

[0058] MRP was diluted to 3.5 mg / ml with 0.01M PBS. Anti-MRP polyclonal antibody was diluted to 2mg / ml with 0.01M PBS. Spray the two on the nitrocellulose membrane at a speed of 1 μl / cm with a film spraying machine to form a test line and a control line, respectively. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a test strip for fast detection of Streptococcus suis (serotype2), which comprises a reaction film and a conjugate release pad. The reaction film has a detection band coated with Streptococcus suis (serotype2) specific antigen MRP, and a quality control band of polyclonal antibody coated with anti Streptococcus suis (serotype2) specific antigen. The conjugate release pad is coated with colloidal gold labeled Streptococcus suis (serotype2) specific antigen, and a membrane chromatography double antigen sandwich method is adopted to detect the Streptococcus suis (serotype2) specific antigen. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base course, large scale detection of an accident and epidemiological investigation, and has auxiliary effect on the diagnosis of Streptococcus suis (serotype2) infection.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a test strip for detecting the specific antibody of Streptococcus suis type 2 and an application thereof. Background technique [0002] Streptococcus suis can cause diseases such as meningitis, arthritis and sepsis in pigs, and can cause sudden death in young pigs. The bacterium can also cause human infection, leading to serious diseases such as meningitis, and is an important zoonotic pathogen. There are 35 serotypes of Streptococcus suis, among which Streptococcus suis type 2 has a global distribution and the highest proportion of clinical isolates. In Streptococcus suis type 2, there are three strains with different virulence: virulent, weak and avirulent. The biggest difference between the virulent strain and the avirulent strain is that the former was MRP+, while the latter was MRP-. MRP+ Streptococcus suis can often cause severe clinical symptoms, while MR...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/558G01N33/545
Inventor 刘明
Owner BEIJING ZHUANGDI HAOHE BIOMEDICINE SCI & TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More