Recombinant vector containing polyhedrosis gene, and method for expressing and purifying protein
A polyhedrin protein and recombinant plasmid technology, applied in the field of protein expression and purification, can solve the problems of difficult purification, time-consuming, and increased difficulty of purification, and achieve the effect of difficult purification, wide application prospects, and increased difficulty of purification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0040] The technical means used in the present invention can be known by those skilled in the art according to "Molecular Cloning" or other technical manuals.
[0041] 1. Primer Design
[0042] Amplify the polyhedron promoter and polyhedron gene, and at the same time introduce protease TEV restriction sites, such as figure 1 shown. In the figure, pPh: polyhedrin promoter; Ph: polyhedrin gene; TEV: TEV protease cleavage site region.
[0043] Primers were designed as follows:
[0044] Upstream primer F: CAAGCTGATATCACTGTCGACAAGCTCTGTCC (italics indicate EcoR V restriction site) SEQ ID No.1;
[0045]Downstream primer R: AGCTACGGATCCGCCCTGAAAATACAGGTTTTCATACGCCGGACCAGTGAACA (Italic indicates the restriction site of BamH I, bold indicates the restriction site of TEV protease) SEQ ID No.2.
[0046] The downstream of the polyhedron gene promoter pPh retains the coding region Ph of the polyhedron gene, and at the same time, the stop codon mutation of the coding region Ph is delete...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 