Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant vector containing polyhedrosis gene, and method for expressing and purifying protein

A polyhedrin protein and recombinant plasmid technology, applied in the field of protein expression and purification, can solve the problems of difficult purification, time-consuming, and increased difficulty of purification, and achieve the effect of difficult purification, wide application prospects, and increased difficulty of purification

Active Publication Date: 2009-07-15
TIANJIN YAOYU BIOLOGICAL TECH
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] When using traditional recombinant insect viruses to screen recombinant viruses with exogenous genes, it is necessary to use a microscope to screen according to the shape of plaques in virus-infected cells. In addition to requiring skilled technology, it is also time-consuming and long-term, and the recombinant target protein obtained is less , not conducive to preservation, and the purification of the target protein is also difficult
In addition, membrane proteins are difficult to purify due to their own hydrophobic properties, and when expressed in expression systems such as Escherichia coli and yeast cells, membrane proteins are generally integrated into the cell membrane, which greatly increases the difficulty of purification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant vector containing polyhedrosis gene, and method for expressing and purifying protein
  • Recombinant vector containing polyhedrosis gene, and method for expressing and purifying protein
  • Recombinant vector containing polyhedrosis gene, and method for expressing and purifying protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0040] The technical means used in the present invention can be known by those skilled in the art according to "Molecular Cloning" or other technical manuals.

[0041] 1. Primer Design

[0042] Amplify the polyhedron promoter and polyhedron gene, and at the same time introduce protease TEV restriction sites, such as figure 1 shown. In the figure, pPh: polyhedrin promoter; Ph: polyhedrin gene; TEV: TEV protease cleavage site region.

[0043] Primers were designed as follows:

[0044] Upstream primer F: CAAGCTGATATCACTGTCGACAAGCTCTGTCC (italics indicate EcoR V restriction site) SEQ ID No.1;

[0045]Downstream primer R: AGCTACGGATCCGCCCTGAAAATACAGGTTTTCATACGCCGGACCAGTGAACA (Italic indicates the restriction site of BamH I, bold indicates the restriction site of TEV protease) SEQ ID No.2.

[0046] The downstream of the polyhedron gene promoter pPh retains the coding region Ph of the polyhedron gene, and at the same time, the stop codon mutation of the coding region Ph is delete...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of gene engineering, in particular to a recombinant vector containing polyhedrosis genes and a method for expressing and purifying proteins. The invention provides a recombinant plasmid pBacPAKph, a recombinant plasmid pBacPAKph-M and a linear virus recon with a connection number of CGMCC No.2768. Linear virus recon BmBacPAKph-M is adopted to infect a host body and express fusion protein of polyhedrosis protein and target protein, the expressed fusion protein is separated and purified, enzyme digestion is carried out on prolease to obtain the target protein. The purified target protein can be prepared into intravenous medicines or used as an object for study on protein functions. A plurality of proteins which are provided by the invention and hard to be expressed and purified but can be easily expressed and purified by protein expression and purification systems, especially membrane proteins have a broad prospect of application.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a recombinant plasmid containing polyhedrin gene, a preparation method thereof, and a protein expression and purification method. Background technique [0002] Insect cell expression system (ie, baculovirus expression system) has unique biological characteristics and has been paid more and more attention by people. During the very late gene expression process of the baculovirus gene, there are two highly expressed proteins, polyhedrin and P10 protein: polyhedrin is the main component of inclusion bodies, and the accumulation in cells at the late stage of infection can be as high as 30% to 50%, forming crystals, which are non-essential components for virus replication; P10 protein is also a non-essential component for virus replication, and can form fibrous substances in cells. Both the polyhedron gene and the P10 gene have been located and cloned now, and the promote...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/63C12N15/66C12N7/01C12N15/866G01N33/68C12R1/93
Inventor 张耀洲吴祥甫陈琴
Owner TIANJIN YAOYU BIOLOGICAL TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More