Recombinant adenovirus expressing mycoplasma hyopneumoniae P102 protein and applications thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A recombinant adenovirus, cgmccno.2987 technology, applied in application, virus/phage, recombinant DNA technology, etc., can solve the problems of inactivated vaccine and attenuated vaccine promotion and application, achieve low human pathogenicity and broad application prospects , good stability
Inactive Publication Date: 2011-10-12
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF0 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0005] At present, the prevention and control of Mhp mainly adopts drug treatment, immunization and population purification. Vaccine immunization mainly uses inactivated vaccines and attenuated vaccines. However, due to various factors, the promotion and application of inactivated vaccines and attenuated vaccines are affected.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1P102
[0039] The mutation of embodiment 1P102 gene
[0040] 1.1 Primer design and PCR amplification
[0041] The 5' end primer of primer A1 is provided with CCACC sequence, ATG promoter, Hind III site, and the 3' end primer is provided with TAA stop codon and Xho I site.
[0042] A1:
A2:
ATGGATCCAAACCTTTTTGGTTAATAA
CAGGTCGACATAATCAGAGAGGCTAAT
Primers for amplifying the A-segment gene
a1:
a2:
AAAAAATGGTCGGCAAAAACAGT
CCGACCATTTTTTAAAATTATCTTTAATT
Mutation at position 241-243
Primer
a3:
a4:
GCTCTTTCAAGTCGTGAAAACCAATTAC
TTCACGACTTGAAAGAGCTTTGGTTG
Mutation at position 610-612
Primer
a5:
a6:
TCTAAAATTCTAAAATCCTGGCTTGAAA
ATTTTAGAATTTTAGAAATTTCCTGATTTG
Mutation at position 877-879
Primer
B1:
B2:
CAGGAATTCTGGTATGGATCTCCGAATTCA
CAGGTCGACAAAAGTGCTTACCTCTGTT
Amplify B segment gene primers
C1:
C2:
CAGGGATCCGCAGAAGAAGCTAAG
CCGGGTCGACTTAC...
Embodiment 2
[0051] Example 2 Construction and Expression of Mycoplasma Hyopneumoniae P102 Gene Recombinant Adenovirus
[0054] Mycoplasma hyopneumoniae Yin-1 strain was isolated and identified in 2005 by our laboratory; P102 gene (mutated sequence SEQ ID NO: 1 obtained in Example 1); E.coliDH5α is a product of Novagen; adenovirus Expression vector system (AdEasy TM XLAdenoviral Vector System) including the shuttle vector pShuttle-CMV, electroporation competent cells BJ5183-AD-1, packaging cells AD-293 and super competent cells XL-10 were purchased from Stratagene.
[0055] 1.2 Main reagents
[0056] Tissue / cell DNA extraction kits, small plasmid extraction kits and gel recovery kits are all products of Shanghai Huashun Company; protein molecular quality standards, restriction endonucleases NotI, HindIII and Pyrobest TM DNA polymerase was produced by Fermentas MBI Company; restriction enzymes Pme I...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention discloses a recombinant adenovirus expressing mycoplasma hyopneumoniae P102 protein and applications thereof. The recombinant adenovirus is obtained by firstly carrying out mutation on gene of the mycoplasma hyopneumoniae P102 protein, cloning the whole genome (SEQ ID No:1) after the mutation onto a shuttle vector pShuttle-CMV, obtaining a recombinant shuttle vector, carrying out electro-transformation into competent cells containing an adenovirus backbone vector after linearization and carrying out homologous recombination in bacteria. The indirect immunofluorescence and the Western Blot identification prove that the recombinant adenovirus successfully expresses the P102 protein. The recombinant adenovirus is used for immunizing female Balb / c mice with 6-8 weeks by two waysof muscle injection and nasal dropping, and the recombinant virus can induce the mice to produce the specific humoral immune and the cellular immune response, thereby indicating that the recombinant adenovirus can be applied in the diagnosis, the prevention or the treatment of mycoplasma pneumoniae of swine.
Description
technical field [0001] The present invention relates to a rearranged cDNA sequence and a recombinant adenovirus containing the cDNA sequence, in particular to a cDNA sequence obtained by rearranging and optimizing the gene encoding the Mycoplasma hyopneumoniae P102 protein, and the present invention also relates to a recombinant adenovirus containing the cDNA The sequenced recombinant adenovirus and their application in the diagnosis, prevention or treatment of swine mycoplasma pneumonia belong to the field of prevention and treatment of swine mycoplasma pneumonia. Background technique [0002] Mycoplasma hyopneumoniae (Mycoplasma, hyopneumoniae, Mhp) is the main pathogen of swine mycoplasma pneumonia (MPS), which is also called porcine endemic pneumonia (EPP). . MPS is characterized by contact, highly contagious, chronic, high morbidity, and low mortality. The main manifestations are cough, dyspnea, and fleshy or marbled lesions in the lung tissue can be seen on dissection...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more