Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human prostate specific antigen expression vector and application thereof

A prostate-specific, expression vector technology, applied in the field of genetic engineering, can solve the problems of reducing biological activity, lack of processing, modification, affecting the correct folding and glycosylation of PSA, and achieving the effects of reduced production cost and easy construction

Inactive Publication Date: 2010-03-03
上海裕隆生物科技有限公司
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The lack of protein post-translational processing and modification in the E. coli expression system will affect the correct folding and glycosylation of post-translational PSA and reduce its biological activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human prostate specific antigen expression vector and application thereof
  • Human prostate specific antigen expression vector and application thereof
  • Human prostate specific antigen expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1, Construction of human prostate-specific antigen Pichia pastoris expression vector pPIC9K-PSA

[0030] as attached figure 1 As shown, the construction steps of the expression vector pPIC9K-PSA:

[0031] 1. Cloning of PSA gene and construction of pMD18-simple-T-PSA vector

[0032] 1. Using the cDNA library purchased from Megaman as a template, use primers P1 and P2 to synthesize a gene with an EcoRI restriction site at the 5' end, a Not I restriction site at the 3' end and a His-tag coding sequence by PCR fragment.

[0033] Primer PI: 5'aaagaattcattgtgggaggctgggagtgcgagaa 3'

[0034] Primer P2: 5'tatgcggccgcatggtgatggtgatgatgggggttggccacgatggtgtcctt 3'PCR reaction system:

[0035] Sterile water 14μl

[0036] 10xExTaq Buffer 2.5μl

[0037] 10xMgCl 22.5μl

[0038] 2.5mM dNTP 2μl

[0039] 10mM P1-5'primer 1μl

[0040] 10mM P2-3'primer 1μl

[0041] ExTaq 0.125μl

[0042] Template 2μl

[0043] PCR cycle: 94°C for 5 minutes denaturation; 94°C for 30 seco...

Embodiment 2

[0053] Example 2. Screening and Induced Expression of Human Prostate Specific Antigen High Copy Strain

[0054] 1. Screening of high-copy positive transformant expression strains

[0055] 1. The pPIC9K-PSA obtained in Example 1 was linearized with Sal I endonuclease, and the linearized plasmid pPIC9K-PSA was obtained by ethanol precipitation.

[0056] 2. The linearized plasmid pPIC9K-PSA was electrotransformed into Pichia pastoris

[0057] 1) Streak Pichia pastoris GS115 on a YPD-plate and culture it at 30°C for 2-3 days to activate it. Pick a monoclonal colony and inoculate it in 50ml YPD liquid medium, and cultivate it to OD at 30°C 600 It is 1.3-1.5.

[0058] 2) Centrifuge the culture solution in step 1) at 3000 rpm at 4°C for 5 minutes to collect yeast cells, and discard the supernatant.

[0059] 3) Suspend the above yeast cell pellet with an equal volume of sterilized water, centrifuge at 3000 rpm at 4°C for 5 minutes to collect the yeast cells, and discard the supern...

Embodiment 3

[0079] Example 3, Separation and Purification of Human Prostate Specific Antigen

[0080] 1) The bacterial cell culture solution of Example 2 was centrifuged, and the expression supernatant was concentrated to 100 ml with PEG20000. In Balance Buffer (the composition is 137mM NaCl, 2.7mM KCl, 10mM NaCl 2 HPO 4 , 2mM KH 2 PO 4 , pH7.4) dialyzed.

[0081] 2) The dialyzed expression supernatant was passed through a High-Affinity Ni-NTA column (purchased from Jinsite Company). Equilibrate the chromatography column with 5 times the column volume of Balance Buffer in advance.

[0082] 3) After loading the sample, wash to the baseline with Balance Buffer, and then use 2 times the column volume of Elution Buffer (the composition is 137mM NaCl, 2.7mM KCl, 10mM NaCl 2 HPO 4 , 2mM KH 2 PO 4 , 250mM imidazole, pH7.4) eluted, and 5ml of the elution peak was collected.

[0083] 4) Take 2 μg of the purified protein sample, stain it with Coomassie brilliant blue after denatured 12% S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a human prostate specific antigen expression vector and application thereof, which aims to provide the human prostate specific antigen expression vector and a recombinant yeastcell into which the vector is introduced, as well as a method for producing and preparing human prostate specific antigen active fragments by utilizing the recombinant cell. The expression vector isa yeast expression vector containing a human prostate specific antigen gene and a His-tag gene. The method for expressing human prostate specific antigens comprises the steps of constructing the recombinant yeast cell, inducing expression through methanol and utilizing metal affinity chromatography to separate and purify the human prostate specific antigens. The human prostate specific antigen expression vector integrates the human prostate specific antigen gene into a yeast cell genome through homologous recombination to perform stable expression, so that the production cost is greatly reduced.

Description

1. Technical field [0001] The invention relates to the field of genetic engineering, in particular to the preparation of a prostate specific antigen expression vector by gene recombination and a method for producing human prostate specific antigen using the expression vector. 2. Technical background [0002] Prostate specific antigen (PSA) is a serine protease present in semen and secreted by prostate duct and acinar epithelial cells under the regulation of androgen. It belongs to the kallikrein family and has pancreatic-like properties. Chymotrypsin, tryptase and lipase activity. In serum, total PSA (t-PSA) includes two forms: free PSA (f-PSA) and f-PSA complexed with α1-antichymotrypsin or α2-macroglobulin (c-PSA), half-life very short. The main function of PSA is to hydrolyze Semenogelin I, II and fibronectin, which are derived from the seminal vesicles and have the function of inhibiting sperm motility, to liquefy the semen so that the sperm can move forward. Natural ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/81C12N15/57C12N1/19C12N9/64C12R1/84
Inventor 穆海东汪宁梅刘纲
Owner 上海裕隆生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com