Paracoccus astaxanthin synthetic operon, expressing vector and applications thereof

An expression vector, astaxanthin technology, applied in the directions of application, introduction of foreign genetic material using a vector, biochemical equipment and methods, etc.

Inactive Publication Date: 2010-07-07
SHANGHAI ACAD OF AGRI SCI
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Paracoccus microorganisms are rich in vitamins, but there is no report on the production of astaxanthin by Paracoccus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Paracoccus astaxanthin synthetic operon, expressing vector and applications thereof
  • Paracoccus astaxanthin synthetic operon, expressing vector and applications thereof
  • Paracoccus astaxanthin synthetic operon, expressing vector and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1 strain separation

[0040] Sludge was taken from the deep water area off the coast of Shanghai, diluted 10-100 times and spread on LB solid medium (15g / L agar, 5g / L yeast extract, 5g / L NaCl, 10g / L tryptone, phosphate buffer pH7.5), cultured at 28°C for 24 hours. Pick a red strain, the colony is round, raised, smooth, moist, with neat edges, colorless, does not produce fluorescent pigments, and Gram staining is negative; further screen the rods without flagella and spores by microscopy strains. After the obtained strain was diluted 104, it was repeatedly homozygous on LB solid plate medium.

Embodiment 2

[0041] The extraction of embodiment 2 total DNA

[0042] The bacterial single strain that is isolated in embodiment 1 is cultivated 16 hours in 10ml liquid LB medium (5g / L yeast extract (Invitrogen), 5g / L NaCl, 10g / L tryptone, phosphate buffer pH7.5) , the cell culture solution was centrifuged at 6,000 g for 5 min to obtain the cell pellet. These pellets were frozen at -20°C for 1 hr. Then use TE (10mM Tris-HCl, 1mM EDTA, pH 8.0) solution to wash once. Add 20 μl of sterile water containing 10 mg / mL lysozyme (Sigma-Aldrich) to suspend, and incubate at 37° C. on a shaking table for 1 hr. Add 50 μl of 0.5 MEDTA, 50 μl of 10% (w / v) SDS and 50 μl of 5M NaCl and shake gently to mix. Then 10 μl of protein kinase K (Takara Japan) at a concentration of 20 mg / mL was added, and the reaction was incubated at 37° C. for 1 hr. DNA was extracted with phenol:chloroform:isoamyl alcohol (25:24:1) equivalent to the volume of the culture liquid (1 volume). The aqueous phase was extracted wit...

Embodiment 3

[0043] Example 3 Paracoccus strain homology analysis

[0044] Using the total DNA extracted in Example 2 as a template, the primers at both ends of the 16s rRNA were used for amplification. The primers for amplification were 16SR1: 5'CAGAGTTTGATCCTGGCTCAG3' and 16SF: 5'TACGGCTACCTTGTTACGACTTC3'. Using KOD Plus (Toyobo Japan) as Taq DNA polymerase, the amplification conditions were as follows: 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 120 seconds, and 30 cycles of amplification. After the cycle was completed, 2 units of rtaq enzyme (Bao Bioengineering (Dalian) Co., Ltd.) were added and extended at 72°C for 300 seconds, and the length of the amplified fragment was 1408bp (see below). After the PCR, 1% (w / v) agarose gel was recovered, and 10 μl was directly connected to the T / A cloning vector (Treasure Bioengineering (Dalian) Co., Ltd.), and connected overnight at 4°C. Then the vector was transformed into DH5α competent. Using the ABI3700 capillary automatic sequencer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a paracoccus astaxanthin synthetic operon with the total length of 6352bp. The method comprises the following steps of: culturing, extracting total DNA and amplifying PCR to obtain the operon with the sequence of SEQ ID No.1. The operon comes from the paracoccum microorganism, thereby having the advantages of safety, nonpathogenic property, little environment pollution and the like. The sequence and the expression vector thereof can be applied to the production of the astaxanthin.

Description

technical field [0001] The invention relates to a pigment synthesis microbial operon, in particular to a pigment synthesis microbial operon of the genus Paracoccus, more specifically to an astaxanthin synthesis operon and its application in astaxanthin synthesis. Background technique [0002] Carotenoid is a kind of natural pigment, which is a general term for a class of hydrocarbons composed of 8 isoprenoid units and their oxidized derivatives (J.Biotech., 1998, 59, 169). [0003] Carotenoids can be divided into four subfamilies, including carotene, such as: α-, β-, γ-carotene, lycopene; carotenoids, such as: lutein, zeaxanthin, astaxanthin; carrot Alcohol esters, such as: β-Apo-8'-carotate; carrot acid, such as: saffron, annatto. The basic structure of carotenoid is lycopene, and other carotenoids are derived from its oxidation, hydrogenation, dehydrogenation, cyclization, rearrangement and degradation of carbon frame. Generally, carotenoids are C40 molecules, but high m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/31C12N15/63C12P23/00C07C403/24C12R1/19
Inventor彭日荷姚泉洪熊爱生薛永高峰付晓燕田永生赵伟孙广东金晓芬
OwnerSHANGHAI ACAD OF AGRI SCI