Paracoccus astaxanthin synthetic operon, expressing vector and applications thereof
An expression vector, astaxanthin technology, applied in the directions of application, introduction of foreign genetic material using a vector, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1 strain separation
[0040] Sludge was taken from the deep water area off the coast of Shanghai, diluted 10-100 times and spread on LB solid medium (15g / L agar, 5g / L yeast extract, 5g / L NaCl, 10g / L tryptone, phosphate buffer pH7.5), cultured at 28°C for 24 hours. Pick a red strain, the colony is round, raised, smooth, moist, with neat edges, colorless, does not produce fluorescent pigments, and Gram staining is negative; further screen the rods without flagella and spores by microscopy strains. After the obtained strain was diluted 104, it was repeatedly homozygous on LB solid plate medium.
Embodiment 2
[0041] The extraction of embodiment 2 total DNA
[0042] The bacterial single strain that is isolated in embodiment 1 is cultivated 16 hours in 10ml liquid LB medium (5g / L yeast extract (Invitrogen), 5g / L NaCl, 10g / L tryptone, phosphate buffer pH7.5) , the cell culture solution was centrifuged at 6,000 g for 5 min to obtain the cell pellet. These pellets were frozen at -20°C for 1 hr. Then use TE (10mM Tris-HCl, 1mM EDTA, pH 8.0) solution to wash once. Add 20 μl of sterile water containing 10 mg / mL lysozyme (Sigma-Aldrich) to suspend, and incubate at 37° C. on a shaking table for 1 hr. Add 50 μl of 0.5 MEDTA, 50 μl of 10% (w / v) SDS and 50 μl of 5M NaCl and shake gently to mix. Then 10 μl of protein kinase K (Takara Japan) at a concentration of 20 mg / mL was added, and the reaction was incubated at 37° C. for 1 hr. DNA was extracted with phenol:chloroform:isoamyl alcohol (25:24:1) equivalent to the volume of the culture liquid (1 volume). The aqueous phase was extracted wit...
Embodiment 3
[0043] Example 3 Paracoccus strain homology analysis
[0044] Using the total DNA extracted in Example 2 as a template, the primers at both ends of the 16s rRNA were used for amplification. The primers for amplification were 16SR1: 5'CAGAGTTTGATCCTGGCTCAG3' and 16SF: 5'TACGGCTACCTTGTTACGACTTC3'. Using KOD Plus (Toyobo Japan) as Taq DNA polymerase, the amplification conditions were as follows: 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 120 seconds, and 30 cycles of amplification. After the cycle was completed, 2 units of rtaq enzyme (Bao Bioengineering (Dalian) Co., Ltd.) were added and extended at 72°C for 300 seconds, and the length of the amplified fragment was 1408bp (see below). After the PCR, 1% (w / v) agarose gel was recovered, and 10 μl was directly connected to the T / A cloning vector (Treasure Bioengineering (Dalian) Co., Ltd.), and connected overnight at 4°C. Then the vector was transformed into DH5α competent. Using the ABI3700 capillary automatic sequencer...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 