Anti-MFAP3L monoclonal antibody and use thereof in tumor detection
A monoclonal antibody and human detection technology, applied in the fields of immunology and cytology, can solve the problems of unprepared specific antibodies and rare functional research, and achieve high specificity and sensitivity, high detection efficiency, and high application. effect of value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] The preparation of embodiment 1MFAP3L antigen
[0032] 1. Cloning, expression and purification of MFAP3L full-length protein
[0033] Using the liver cDNA library as a template, design specific primers according to the gene corresponding to the MFAP3L sequence (SEQ ID NO: 1), and connect the two ends of the primers to the BamHI and HindIII restriction sites:
[0034] Upstream primer: 5'AGCAGGATCCATGGATCGATTGAAGAGC 3'
[0035] Downstream primer: 5'CCCAAGCTTTTAGACATGGCTTTCGTA 3'
[0036]The full-length MFAP3L gene was amplified by PCR, (PCR parameters: 95°C for 5 minutes, 94°C for 30s, 54°C for 30s, 72°C for 1 minute, a total of 40 cycles; 72°C and then extended for 10 minutes) after double enzyme digestion and pET28a Connect, transform competent cells DH5a by heat shock, pick a single clone to extract the plasmid for sequencing, and verify that the sequence is correct. Extract the pET28a-MFAP3L plasmid from the positive bacteria with correct sequencing, transform BL21...
Embodiment 2
[0039] Embodiment 2: Preparation of anti-MFAP3L hybridoma
[0040] 1. Immunity
[0041] Using purified MFAP3L protein as antigen, routinely immunize 3 female Balb / c mice at the age of 4-6 weeks (take 20ul serum from the orbit before immunization as negative control); 180ugMFAP3L protein + normal saline to 600ul + CFA600ul; abdominal subcutaneous injection for each mouse Mouse 6 o'clock. The immune dose is 60ug / 200ul / only. Booster immunization once every 14 days, 90ug protein + normal saline to 600ul + IFA600ul; subcutaneously inject 6 points per mouse. The immune dose is 30ug / 200ul / only. Seven days after the third time, blood was taken from the eye socket to measure the potency, and those who met the requirements were subjected to shock immunity, 50ug protein + normal saline to 100ul; tail vein injection.
[0042] 2. Fusion
[0043] 1. Observe the state of sp2 / 0 cells (Concord Cell Bank), and blow the selected sp2 / 0 cells off the wall of the culture flask, and then suck t...
Embodiment 3
[0060] Example 3: Preparation of anti-MFAP3L monoclonal antibody by hybridoma with deposit number CGMCC 2840
[0061] The inventor used hybridoma (70016-1, date of deposit on December 30, 2008, deposit number CGMCC 2840, place of deposit: General Microbiology Center CGMCC, China Committee for Culture Collection of Microorganisms) to prepare mouse anti-MFAP3L monoclonal antibody, specifically The operation steps are as follows:
[0063] Cells follow the principle of slow freezing and quick thawing. Quickly take out the cryopreservation tube from the -80°C refrigerator or liquid nitrogen tank; quickly put it into the water bath and stir quickly to make the cryopreservation solution melt into liquid within 2 minutes. Wipe the cryovials with 75% alcohol. Add 3ml of serum medium to the 15ml centrifuge tube, suck the cryopreserved solution into the centrifuge tube, centrifuge at 1500rad / min for 5 minutes. Discard the supernatant, suspend the cells with ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 