Unlock instant, AI-driven research and patent intelligence for your innovation.

Anti-MFAP3L monoclonal antibody and use thereof in tumor detection

A monoclonal antibody and human detection technology, applied in the fields of immunology and cytology, can solve the problems of unprepared specific antibodies and rare functional research, and achieve high specificity and sensitivity, high detection efficiency, and high application. effect of value

Active Publication Date: 2013-01-16
BEIJING PROTEIN INNOVATION
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

MFAP3L is a gene related to spermatogenesis cloned from the cDNA library of human testis in 2002. So far, there are few studies on its function, and the specific antibody for detecting this protein has never been prepared

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-MFAP3L monoclonal antibody and use thereof in tumor detection
  • Anti-MFAP3L monoclonal antibody and use thereof in tumor detection
  • Anti-MFAP3L monoclonal antibody and use thereof in tumor detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The preparation of embodiment 1MFAP3L antigen

[0032] 1. Cloning, expression and purification of MFAP3L full-length protein

[0033] Using the liver cDNA library as a template, design specific primers according to the gene corresponding to the MFAP3L sequence (SEQ ID NO: 1), and connect the two ends of the primers to the BamHI and HindIII restriction sites:

[0034] Upstream primer: 5'AGCAGGATCCATGGATCGATTGAAGAGC 3'

[0035] Downstream primer: 5'CCCAAGCTTTTAGACATGGCTTTCGTA 3'

[0036]The full-length MFAP3L gene was amplified by PCR, (PCR parameters: 95°C for 5 minutes, 94°C for 30s, 54°C for 30s, 72°C for 1 minute, a total of 40 cycles; 72°C and then extended for 10 minutes) after double enzyme digestion and pET28a Connect, transform competent cells DH5a by heat shock, pick a single clone to extract the plasmid for sequencing, and verify that the sequence is correct. Extract the pET28a-MFAP3L plasmid from the positive bacteria with correct sequencing, transform BL21...

Embodiment 2

[0039] Embodiment 2: Preparation of anti-MFAP3L hybridoma

[0040] 1. Immunity

[0041] Using purified MFAP3L protein as antigen, routinely immunize 3 female Balb / c mice at the age of 4-6 weeks (take 20ul serum from the orbit before immunization as negative control); 180ugMFAP3L protein + normal saline to 600ul + CFA600ul; abdominal subcutaneous injection for each mouse Mouse 6 o'clock. The immune dose is 60ug / 200ul / only. Booster immunization once every 14 days, 90ug protein + normal saline to 600ul + IFA600ul; subcutaneously inject 6 points per mouse. The immune dose is 30ug / 200ul / only. Seven days after the third time, blood was taken from the eye socket to measure the potency, and those who met the requirements were subjected to shock immunity, 50ug protein + normal saline to 100ul; tail vein injection.

[0042] 2. Fusion

[0043] 1. Observe the state of sp2 / 0 cells (Concord Cell Bank), and blow the selected sp2 / 0 cells off the wall of the culture flask, and then suck t...

Embodiment 3

[0060] Example 3: Preparation of anti-MFAP3L monoclonal antibody by hybridoma with deposit number CGMCC 2840

[0061] The inventor used hybridoma (70016-1, date of deposit on December 30, 2008, deposit number CGMCC 2840, place of deposit: General Microbiology Center CGMCC, China Committee for Culture Collection of Microorganisms) to prepare mouse anti-MFAP3L monoclonal antibody, specifically The operation steps are as follows:

[0062] 1. Cell Recovery

[0063] Cells follow the principle of slow freezing and quick thawing. Quickly take out the cryopreservation tube from the -80°C refrigerator or liquid nitrogen tank; quickly put it into the water bath and stir quickly to make the cryopreservation solution melt into liquid within 2 minutes. Wipe the cryovials with 75% alcohol. Add 3ml of serum medium to the 15ml centrifuge tube, suck the cryopreserved solution into the centrifuge tube, centrifuge at 1500rad / min for 5 minutes. Discard the supernatant, suspend the cells with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a hybrid tumor having an anti-MFAP3L monoclonal antibody, the anti-MFAP3L monoclonal antibody and the use of the anti-MFAP3L monoclonal antibody in tumor detection, in particular to a hybrid tumor having a monoclonal antibody which can be specifically combined with a natural protein, namely microfibrillar-associated protein 3-like (MFAP3L), in human colorectal carcinoma tissues and normal tissues and the corresponding antibody. Furthermore, the invention relates to an immune detection reagent containing the monoclonal antibody and the use of the monoclonal antibody orthe detection reagent in effective detection of colorectal carcinoma, thereby providing a detection tool for effectively detecting the MFAP3L.

Description

technical field [0001] The present invention relates to the fields of immunology and cytology. Specifically, the present invention provides a hybridoma that can produce a monoclonal antibody that binds to a natural antigen of human colorectal cancer cells, and the monoclonal antibody produced by the hybridoma can be used as a diagnostic reagent for human colorectal cancer or Related field. Background technique [0002] Colorectal cancer, also known as colorectal cancer, ranks fifth among common malignant tumors in my country. In the past 25 years, with the improvement of people's living standards and the change of diet structure, its incidence rate has been on the rise, and the rate of increase ranks first among various malignant tumors. The liver is the most likely metastatic organ of colorectal cancer, known as the "first stop" of colorectal cancer organ metastasis, and it is one of the main causes of death in colorectal cancer patients. Throughout the course of the dis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/18G01N33/577C12N5/18
Inventor 康滨张军邢蕊徐宁志吕有勇吴琳刘国振刘斯奇
Owner BEIJING PROTEIN INNOVATION