Method for efficiently expressing DNA polymerase by using pichia pastoris

A technology of Pichia pastoris and polymerase, which is applied in the direction of recombinant DNA technology, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems of reducing enzyme activity, difficult purification, high cost, etc., and achieves improved fidelity and operation The effect of cumbersome steps and time-consuming

Inactive Publication Date: 2012-07-04
HUBEI UNIV +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, many studies at home and abroad express the genes encoding extremases in heterologous common host bacteria (such as Escherichia coli). Most of the proteins expressed by this method can maintain the original thermal stability. Folding is not hydrolyzed by the host protease, so it can be purified by removing the host protein by heat denaturation method, and the enzyme yield is also improved. It is a relatively economical method, which promotes the wide application of PCR technology to a certain extent, and Saved the PCR cost, but still faced various problems such as difficult purification and higher cost in this process ( Baneyx Recombinant protein expression in Escherichia coli Current Opinion in Biotechnology Volume 10, Issue 5, 1 October 1999, Pages 411-421)
For example, if the culture temperature is too high, the growth rate is too fast or the growth is excessive, most of the target proteins expressed by foreign genes are likely to form inclusion bodies, which requires conversion into soluble proteins. This step is not only cumbersome but also reduces enzyme activity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently expressing DNA polymerase by using pichia pastoris
  • Method for efficiently expressing DNA polymerase by using pichia pastoris
  • Method for efficiently expressing DNA polymerase by using pichia pastoris

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Using the method of the present invention to express in yeast the DNA polymerase gene derived from the Thermococcus kodakarensis strain synthesized by our laboratory, which is collectively referred to as RKOD hereinafter. Firstly, the pHBM905A plasmid is sequentially digested with restriction endonucleases Cop I and Not I to generate a vector with two fixed base single-stranded cohesive ends, and the vector is recovered by agarose gel. Secondly, according to the known gene sequence, use GeneTool software to design RKOD-905a F: 5′ GTCA ATGATCCTCGACACTGACTACATAACCG 3′ and RKOD-905a R: 5′ GGCCA Two primers TTATTTTTTCTGTTTTTCCAGCATCTGC 3′ were used for PCR amplification with primerstar DNA polymerase to obtain the RKOD (2.5kb) gene fragment, which was recovered from the agarose gel and treated with T4 DNA polymerase at 12°C for 20 minutes in the presence of dTTP , generate cohesive ends that pair with the pHBM905A vector, and recover fragments. Then the vector and the f...

Embodiment 2

[0029] The DNA polymerase gene (RKOD gene) derived from Thermococcus kodakarensis strain synthesized in our laboratory was expressed by the Escherichia coli expression system, as a comparison of Example 1, to verify the superiority of the method of expressing DNA polymerase by yeast. First, according to the known gene sequence, use GENETOOL software to design primers (forward primer: 5'ATGATCCTCGACACTGACTACATAACCG 3'; reverse primer: 5'TTATTTTTTTCTGTTTTTCCAGCATCTGC 3') to amplify the RKOD gene fragment, and agarose gel electrophoresis detects clear bands After banding, the fragment was recovered from an agarose gel. Then the pET-30a plasmid was digested with the restriction endonuclease EcoRV at 37°C for 2 hours to form a linear blunt-ended vector. Then the vector and the fragment were ligated by Solution I enzyme at 16°C for 2 hours, then transformed into Escherichia coli DH10β competent cells, the transformants were screened on the Kanamycin LB plate, and the recombinant was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for expressing a DNA polymerase from Thermococcus kodakarensis strain by using pichia pastoris, which comprises the following steps of: 1) cloning the DNA polymerase gene to a pichia pastoris secretion type expression vector to obtain pichia pastoris recombinant expression plasmid; 2) converting the recombinant expression plasmid into pichia pastoris host cell GS115 by electric shock, and identifying and screening a positive clone through an MD panel and a PCR; and 3) performing induction expression on the selected positive clone by using 0.5 percent methanol. The method can be used for expressing the DNA polymerase gene from the Thermococcus kodakarensis strain. Through verification, compared with an Escherichia coli expression system, the method can improve the performance such as the heat stability and the like of the DNA polymerase obviously, reduce the production cost, shorten the process flow and simplify purifying steps.

Description

technical field [0001] The present invention relates to the induced expression technology of exogenous genes, especially a method for expressing DNA polymerase by using Pichia pastoris, which is a new idea, new approach and new method for the expression and production of DNA polymerase. Background technique [0002] Polymerase chain reaction (polymerase chain reaction, PCR) is one of the most important basic research methods in modern molecular biology. This technology is widely used in the fields of molecular biology, medicine and other related disciplines because of its advantages of simple operation, rapidity, high sensitivity and strong specificity. [0003] As one of the important tools in the polymerase chain reaction, DNA polymerase plays a vital role in the PCR process. Until 1988, Rand ll K Saiki et al. (Saiki R K, Gelfand D H, Stoffel S, ScharfS, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 1988, 239: 487-491) ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/54C12N15/81C12N9/12
Inventor马立新余晓岚卞璐赵慧廖峰赵宝凯刘美
OwnerHUBEI UNIV