Mutated human-source fibroblast growth factor and application in treating endocrine diseases
An endocrine disease, growth factor technology, applied in the direction of fibroblast growth factor, growth factor/inducing factor, metabolic disease, etc., can solve the problem of wasting manpower and material resources, and achieve lower blood sugar level, longer duration of drug effect, faster The effect of medicinal development
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Cloning of hFGF-21 gene
[0025] According to the amino acid sequence of hFGF-21 gene with signal peptide removed, primers were designed, and human FGF-21 gene with signal peptide removed was obtained by complementary extension. Primers for hFGF-21 were designed using the online software Primer5.0.
[0026] Using the extracted normal human liver total RNA as a template, Oligo(dT) 15 As primers, the first strand of cDNA was synthesized according to the instructions of M-MLV reverse transcriptase M-MLVRT. The reaction system and specific operations were as follows:
[0027] Oligo(dT) 15 1.0μl
[0028] Template 5.0μl
[0029] DEPC-H 2 O 7.0 μl
[0030] Water bath at 70°C for 5 minutes, place on ice for 5 minutes, add in sequence:
[0031] RNasin 1.0μl
[0032] 5×M-MLVRT buffer 5.0μl
[0033] dNTPs 5.0μl
[0034] M-MLVRT 1.0 μl
[0035] 37 ° C water bath for 2 hours, 70 ° C water bath for 15 minutes, take 2 μ l for PCR amplification reaction. T...
Embodiment 2
[0047] Example 2 Cloning of hmFGF-21 gene
[0048] 1. Construction and design of hmFGF-21 gene
[0049] Design six primers, use overlapping PCR method to construct hmFGF-21 protein gene (such as Figure 3-1 ). The six primers were designed as follows:
[0050] Primer262: 5′ GGTCTCCGAGGT CACCCCATCCCTGACTCCAGT 3′
[0051] Bsa I
[0052] Primer355: 5 TCAGACTGGTACACATTGTAA 3′
[0053] Pairing region with mFGF-21 Pairing region with hFGF-21
[0054] Primer356: 5 TTACAATGTGTACCAGTCTGA 3′
[0055] Pairing region with hFGF-21 Pairing region with mFGF-21
[0056] Primer357: 5′ GCTCAGGGGGTCAGAGGAGCC 3′
[0057] Pairing region with hFGF-21 Pairing region with mFGF-21
[0058] Primer369: 5′
[0059] Pairing region with FGF-21
[0060] CCATGCTCAGGGGGTCAGAGG 3′
[0061] Pairing region with FGF-21
[0062] Primer263: 5′ CGC GGATCC TTAGGAAGCGTAGCTGGGGC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
