Mutated human-source fibroblast growth factor and application in treating endocrine diseases

An endocrine disease, growth factor technology, applied in the direction of fibroblast growth factor, growth factor/inducing factor, metabolic disease, etc., can solve the problem of wasting manpower and material resources, and achieve lower blood sugar level, longer duration of drug effect, faster The effect of medicinal development

Active Publication Date: 2011-01-05
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the past biopharmaceutical research, artificial mutations were often used for protein modification. Due to the randomness of mutations and the complexity of protein functions, the results of artificial mutations are often counterproductive, wasting a lot of manpower and material resources

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutated human-source fibroblast growth factor and application in treating endocrine diseases
  • Mutated human-source fibroblast growth factor and application in treating endocrine diseases
  • Mutated human-source fibroblast growth factor and application in treating endocrine diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Cloning of hFGF-21 gene

[0025] According to the amino acid sequence of hFGF-21 gene with signal peptide removed, primers were designed, and human FGF-21 gene with signal peptide removed was obtained by complementary extension. Primers for hFGF-21 were designed using the online software Primer5.0.

[0026] Using the extracted normal human liver total RNA as a template, Oligo(dT) 15 As primers, the first strand of cDNA was synthesized according to the instructions of M-MLV reverse transcriptase M-MLVRT. The reaction system and specific operations were as follows:

[0027] Oligo(dT) 15 1.0μl

[0028] Template 5.0μl

[0029] DEPC-H 2 O 7.0 μl

[0030] Water bath at 70°C for 5 minutes, place on ice for 5 minutes, add in sequence:

[0031] RNasin 1.0μl

[0032] 5×M-MLVRT buffer 5.0μl

[0033] dNTPs 5.0μl

[0034] M-MLVRT 1.0 μl

[0035] 37 ° C water bath for 2 hours, 70 ° C water bath for 15 minutes, take 2 μ l for PCR amplification reaction. T...

Embodiment 2

[0047] Example 2 Cloning of hmFGF-21 gene

[0048] 1. Construction and design of hmFGF-21 gene

[0049] Design six primers, use overlapping PCR method to construct hmFGF-21 protein gene (such as Figure 3-1 ). The six primers were designed as follows:

[0050] Primer262: 5′ GGTCTCCGAGGT CACCCCATCCCTGACTCCAGT 3′

[0051] Bsa I

[0052] Primer355: 5 TCAGACTGGTACACATTGTAA 3′

[0053] Pairing region with mFGF-21 Pairing region with hFGF-21

[0054] Primer356: 5 TTACAATGTGTACCAGTCTGA 3′

[0055] Pairing region with hFGF-21 Pairing region with mFGF-21

[0056] Primer357: 5′ GCTCAGGGGGTCAGAGGAGCC 3′

[0057] Pairing region with hFGF-21 Pairing region with mFGF-21

[0058] Primer369: 5′

[0059] Pairing region with FGF-21

[0060] CCATGCTCAGGGGGTCAGAGG 3′

[0061] Pairing region with FGF-21

[0062] Primer263: 5′ CGC GGATCC TTAGGAAGCGTAGCTGGGGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a mutated human-source fibroblast growth factor and application in treating endocrine diseases. The amino acid sequence of the mutated human-source fibroblast growth factor-21 is shown as SEQ ID NO: 2, and the coding genetic sequence is shown as SEQ ID NO: 1. In the invention, a human blood cell nucleic acid is used as a template, FGF-21 genes in a normal human body can be cloned by means of a natural gene bank in quantity, a natural human FGF-21 sample bank can be established, and the natural mutant of the FGF-21 can be obtained by a high-flux screening method. Zoological experiment results prove that the mutated FGF-21 can more effectively reduce the blood sugar level in an animal body, and the mutant has the advantages of quick response, long efficacy duration and the like in the aspect of reducing the blood sugar level. The mutated FGF-21 can be used as medicament for treating diabetes mellitus, metabolic syndrome or lipid metabolism disorder and other endocrine diseases.

Description

technical field [0001] The present invention relates to fibroblast growth factor, in particular to mutated human-derived fibroblast growth factor and its preparation method. The present invention also relates to the use of the mutated human-derived fibroblast growth factor in the preparation of drugs for treating endocrine diseases, which belongs to fibroblast growth factor factor field. Background technique [0002] Diabetes is the third biggest killer of humans after cardiovascular and cerebrovascular diseases and tumors. With changes in lifestyle and diet, the prevalence of diabetes worldwide is on the rise. It is estimated that the number of people with diabetes in the world will increase to 366 million by 2030, and diabetes will become a heavy burden for all countries in the world. [0003] For type 2 diabetes, the vast majority of patients will inevitably be treated with drugs. Among them, there are three major categories of oral drugs: the first category is yellow ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/50C07K1/22C12N15/12C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12N15/62A61K38/18A61P3/00A61P3/06A61P3/10
Inventor 李德山高华山任桂萍王文飞刘铭瑶
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap