Marker-free gene deletion attenuated mutant strain of Edwardsiella tarda wild strain as well as relevant preparations and application thereof

A marker-free gene and mutant technology, applied in microorganism-based methods, bacteria, microorganisms, etc., to achieve the effects of easy differentiation, good control effect, and improved environmental safety and controllability

Active Publication Date: 2011-02-16
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In view of this, this type of attenuated vaccine has been identified as a biological product with high environmental safety risks by the approval regulations of biological product safety inspection and management agencies in various countries, including China, and it is difficult to enter the commercial development process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Marker-free gene deletion attenuated mutant strain of Edwardsiella tarda wild strain as well as relevant preparations and application thereof
  • Marker-free gene deletion attenuated mutant strain of Edwardsiella tarda wild strain as well as relevant preparations and application thereof
  • Marker-free gene deletion attenuated mutant strain of Edwardsiella tarda wild strain as well as relevant preparations and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] In order to understand the technical content of the present invention more clearly, the following examples are given in detail. Example 1 Construction of Markerless Gene Deletion Attenuated Mutants

[0032] (1) Construction of eseB, escA, eseC, and eseD gene deletion strains

[0033] 1) PCR amplification to obtain the desired gene fragment

[0034] Such as figure 1 As shown, the genome of Edwardsiella tarda EIB202 (Edwardsiella tarda EIB 202) (preservation number CCTCCNO: M 208068, preserved at the Chinese Type Culture Collection Center of Wuhan University, preserved on May 1, 2008) as a template , using the following amplification primers:

[0035] P1(GGAAGATCTCGCCTTTCACACGTTACAGCAAGAG),

[0036] P2(GCTGGGCATCCGATTAGCCACCTGCTGGGA),

[0037] P3(CAGGTGGCTAATCGGATGCCCAGCAAAAGA),

[0038] P4(ACATGCATGCCCTGCGACTGACGCGACATGTCATT),

[0039] First, use P1 and P2, P3 and P4 to amplify the upper and lower fragments F1 and F2 required by Overlap PCR respectively. After re...

Embodiment 2

[0060] Embodiment 2: Taking turbot (Scophthamus maximus (L.)) as the semi-lethal dose LD of experimental animals 50 Determination:

[0061] The fish used in the experiment were first placed in the SPF (Specific Pathogen Free) laboratory to adapt to breeding for 1 week to remove abnormal individuals. Before the infection test, the SPF test fish were stocked in the 10L infection test tank in the infection laboratory (Challenge Lab), and continued to be fed for 1 week, and 10 fish were stocked in each tank (average body length 11-12cm, body weight 30g). The test tank uses sterile old seawater to replace 2 / 3 of the volume of aquaculture water every day, and the water temperature is 16°C, with a fluctuation of 2°C.

[0062] The fish used in the test were randomly divided into groups, and two tanks were tested in parallel in each group. In the infection test, each group of test fish was treated with a certain gradient dose (10 2 -10 9 CFU / ml) of Edwardsiella tarda wild strain an...

Embodiment 3

[0067] Embodiment 3: Taking turbot as the experimental animal's immune protection test by injection

[0068] Experimental turbot were randomly divided into 4 groups, with 3 parallel tanks in each group, 10 fish per tank. The prepared attenuated live vaccine was immunized by intramuscular injection. The immunization dose is 10 2 ~10 8 CFU / tail, turbot tested by intramuscular injection. The control group was injected with sterile normal saline. After 4 weeks of immunization, the immunized turbot of each group was infected with live bacteria of Edwardsiella tarda wild strain (intramuscular injection for 10 days). 6 CFU / tail) for artificial infection challenge. Observe and count the control group and the number of immune deaths within 15 days to calculate the immune protection rate of each group (see Table 2). Wherein, the immune protection rate was calculated according to the following formula: immune protection rate%=(control group death rate−immune group death rate%) / cont...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a marker-free gene deletion attenuated mutant strain of an Edwardsiella tarda wild strain. The marker-free gene deletion attenuated mutant strain is an attenuated live vaccine of an Edwardsiella tarda virulent strain, which deletes the chorismic acid synthase gene aroC of the Edwardsiella tarda virulent strain, three types of secretion system response element genes of eseB, escA, eseC and eseD and an endogenous plasmid, preferably, the Edwardsiella tarda virulent strain is an Edwardsiella tarda virulent strain EIB202 with the preservation number of CCTCC No:M208068; the endogenous plasmid is a plasmid of pEIB202; and the marker-free gene deletion attenuated mutant strain of the Edwardsiella tarda virulent strain is an attenuated strain WED with the preservation number of CCTCC No:M2010278. The invention also provides relevant preparations and application of the marker-free gene deletion attenuated mutant strain. The attenuated mutant strain or relevant preparations eliminate the potential environment and safety risk of products existing in the traditional attenuated live vaccines generally and is a safe, effective and economic vaccine aiming at Edwardsiella tarda diseases of cultured fishes.

Description

technical field [0001] The present invention relates to the technical field of attenuated mutant strains, in particular to the technical field of bacterial live attenuated vaccines for fish, and specifically refers to an unmarked gene-deleted attenuated mutant strain of a wild strain of Edwardsiella tarda, related preparations and applications thereof . Background technique [0002] In view of the continuous growth of the world population and the depletion of natural fishery resources, aquaculture, as a traditional industry, has developed rapidly and effectively in modern times, and has highlighted its important position in society, economy and people's life. According to statistics, in 2002, the total amount of aquatic products in my country accounted for 71% of the global total output and 49.8% of the total output value, ranking first in the world. According to FAO statistics, in 2004 the total amount of aquatic products in my country reached 47.5 million tons. However, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/02C12N1/20A61P31/04C12R1/01
Inventor王启要陈涛王鑫肖静凡刘琴张元兴
OwnerEAST CHINA UNIV OF SCI & TECH