Bivalent RNAi expression vector and application of soybean trypsin inhibitor KTi and agglutinin SBA
A technology of trypsin inhibition and expression vector, which is applied in the field of construction and application of expression vector for soybean quality improvement, and can solve the problems of no trypsin inhibitor or lectin inhibition
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1 Extraction of soybean total RNA extraction and synthesis of cDNA
[0051] Extraction of RNA: TRIzoL kit (TaKaRa Company) was used to extract total RNA from the grains of soybean variety "Jinong 17" in the middle and late stages of maturity, and then reverse transcribe it into cDNA.
[0052] Reverse transcription reaction system: the reaction system is 20 μL, including 4.0 μL of 5× buffer, 2.0 μL of dNTP (10 mM), 2.0 μL of universal primer, 1 μL of reverse transcriptase, 0.5 μL of RNase inhibitor, 4 μL of template, ddH 2 O 6.5 μL. All the above reagents were purchased from TaKaRa Company.
Embodiment 2
[0053] Cloning, screening and identification of the soybean trypsin inhibitor gene KTi gene fragment of embodiment 2
[0054] Primers were designed according to the conserved sequence of the KTi3 gene sequence (S45092) published by GenBank, and a 324bp fragment was selected as the mRNA that interferes with the KTi type trypsin inhibitor gene. The Pst I and Sal I sites were introduced respectively, and the primer sequences were as follows (the underlined part is the enzyme cutting site added):
[0055] Primer1: 5′ TTT CTG CAG AAGTCAGACATAACAGCAT 3′ (Pst I)
[0056] Primer2: 5′ TTT GTC GAC TTCATCATCAGAAACTC 3′ (Sal I)
[0057] Using the soybean cDNA synthesized in Example 1 as a template;
[0058] PCR reaction system: the reaction system is 25 μL, where (NH 1 ) 2 SO 4 Buffer 2.5μl, MgCl 2 2.5 μl, 0.5 μl of dNTPMixture (10 mM), 1 μl of each primer (synthesized by Beijing Sanbo Yuanzhi Biotechnology Co., Ltd.), 1 μl of template cDNA, 0.1 μl of Taq enzyme, ddH 2 O17.4...
Embodiment 3
[0066] Embodiment 3 SBA gene fragment PCR cloning, screening and identification
[0067] According to the known soybean lectin gene sequence (AY342213) in GeneBanK, artificial oligonucleotide amplification was designed. In order to facilitate the construction of recombinant plant expression vectors, Sal I and Xba I sites were introduced at the 5′ ends of the upstream and downstream primers respectively. As follows (the underlined part is the added restriction site):
[0068] Primer1: 5′ TTT GTC GAC ATCCACATTTGGGACAGC 3′ (Sal I)
[0069] Primer2: 5′GGG TCT AGATGGCAAATTGGAAGAAAA 3′ (Xba I)
[0070] Using the soybean cDNA synthesized in Example 1 as a template;
[0071] PCR reaction system: the reaction system is 25 μL, where (NH 4 ) 2 SO 4 Buffer 2.5μl, MgCl 2 2.5 μl, 0.5 μl of dNTP Mixture (each 10 mM), 0.5 μl of each primer, 0.3 μl of template, 0.3 μl of Taq enzyme (MBI company), ddH 2 O18.4μL; the above reagents were purchased from MBI Company;
[0072] PCR amp...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com