Unlock instant, AI-driven research and patent intelligence for your innovation.

Bivalent RNAi expression vector and application of soybean trypsin inhibitor KTi and agglutinin SBA

A technology of trypsin inhibition and expression vector, which is applied in the field of construction and application of expression vector for soybean quality improvement, and can solve the problems of no trypsin inhibitor or lectin inhibition

Inactive Publication Date: 2011-09-07
JILIN AGRICULTURAL UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0012] At present, there is no research on simultaneous inhibition of trypsin inhibitors or lectins at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bivalent RNAi expression vector and application of soybean trypsin inhibitor KTi and agglutinin SBA
  • Bivalent RNAi expression vector and application of soybean trypsin inhibitor KTi and agglutinin SBA
  • Bivalent RNAi expression vector and application of soybean trypsin inhibitor KTi and agglutinin SBA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 Extraction of soybean total RNA extraction and synthesis of cDNA

[0051] Extraction of RNA: TRIzoL kit (TaKaRa Company) was used to extract total RNA from the grains of soybean variety "Jinong 17" in the middle and late stages of maturity, and then reverse transcribe it into cDNA.

[0052] Reverse transcription reaction system: the reaction system is 20 μL, including 4.0 μL of 5× buffer, 2.0 μL of dNTP (10 mM), 2.0 μL of universal primer, 1 μL of reverse transcriptase, 0.5 μL of RNase inhibitor, 4 μL of template, ddH 2 O 6.5 μL. All the above reagents were purchased from TaKaRa Company.

Embodiment 2

[0053] Cloning, screening and identification of the soybean trypsin inhibitor gene KTi gene fragment of embodiment 2

[0054] Primers were designed according to the conserved sequence of the KTi3 gene sequence (S45092) published by GenBank, and a 324bp fragment was selected as the mRNA that interferes with the KTi type trypsin inhibitor gene. The Pst I and Sal I sites were introduced respectively, and the primer sequences were as follows (the underlined part is the enzyme cutting site added):

[0055] Primer1: 5′ TTT CTG CAG AAGTCAGACATAACAGCAT 3′ (Pst I)

[0056] Primer2: 5′ TTT GTC GAC TTCATCATCAGAAACTC 3′ (Sal I)

[0057] Using the soybean cDNA synthesized in Example 1 as a template;

[0058] PCR reaction system: the reaction system is 25 μL, where (NH 1 ) 2 SO 4 Buffer 2.5μl, MgCl 2 2.5 μl, 0.5 μl of dNTPMixture (10 mM), 1 μl of each primer (synthesized by Beijing Sanbo Yuanzhi Biotechnology Co., Ltd.), 1 μl of template cDNA, 0.1 μl of Taq enzyme, ddH 2 O17.4...

Embodiment 3

[0066] Embodiment 3 SBA gene fragment PCR cloning, screening and identification

[0067] According to the known soybean lectin gene sequence (AY342213) in GeneBanK, artificial oligonucleotide amplification was designed. In order to facilitate the construction of recombinant plant expression vectors, Sal I and Xba I sites were introduced at the 5′ ends of the upstream and downstream primers respectively. As follows (the underlined part is the added restriction site):

[0068] Primer1: 5′ TTT GTC GAC ATCCACATTTGGGACAGC 3′ (Sal I)

[0069] Primer2: 5′GGG TCT AGATGGCAAATTGGAAGAAAA 3′ (Xba I)

[0070] Using the soybean cDNA synthesized in Example 1 as a template;

[0071] PCR reaction system: the reaction system is 25 μL, where (NH 4 ) 2 SO 4 Buffer 2.5μl, MgCl 2 2.5 μl, 0.5 μl of dNTP Mixture (each 10 mM), 0.5 μl of each primer, 0.3 μl of template, 0.3 μl of Taq enzyme (MBI company), ddH 2 O18.4μL; the above reagents were purchased from MBI Company;

[0072] PCR amp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a bivalent RNAi expression vector and application of a soybean trypsin inhibitor KTi and agglutinin SBA. Soybean trypsin inhibitor KTi and agglutinin SBA genes are cloned from a soybean grain, and green fluorescent proteins GFP serve as intermediate segments to establish the bivalent RNAi expression vector of the KTi and the SBA of a large stem loop structure; based on a plant expression vector pCAMBIA3301, a recombinant expression vector pCAMBIA3301-1alphaP-SBAF-KTiF-GFP-KTiZ-ABAZ is obtained by using a special promoter of a soybean seed and inserting KTi and SBA dual interference elements of the large stem loop structure. The activity of trypsin inhibitors of obtained transgenic soybean varieties is reduced by 83% on average, and the activity of the agglutinin is also greatly reduced; thus, the processing cost of feed is reduced, and a higher economic benefit is expected to be increased for the stock farming industry.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to the construction and application of an expression vector for improving soybean quality. Background technique [0002] Trypsin inhibitor and agglutinin are the main nutritional inhibitors of soybean (Glycine max), which greatly affect the quality of soybean products and the development of new products. [0003] Trypsin inhibitors are the most important class of antinutritional factors in soybean protein. Soybean trypsin inhibitors (Soybean Trypsin Inhibitors, STI) mainly exist in soybean seeds, accounting for 6% to 8% of the total soybean seed protein. STIs are mainly divided into two categories: Kunitz inhibitors (KTIs) and Bowman-Birk inhibitors (BBIs). Wherein the KTi type soybean trypsin inhibitor plays the main anti-nutritional effect, the content is about 1.4%, and the expression form is the protein of 21.5kDa, and trypsin has specific inhibitory property; The BBi content is a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/66C12N1/21A01H5/00C12R1/01
Inventor 王丕武杜娟付永平
Owner JILIN AGRICULTURAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More