Recombinant virus and method for producing L-asparaginase II by using virus
An asparaginase and recombinant virus technology, applied in the field of biological science, can solve the problems of low production level, many separation and purification steps, etc., and achieve the effects of stable gene expression products, stable expression products and good safety.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0022] This specific embodiment is only an explanation of the present invention, and it is not a limitation of the present invention. Those skilled in the art can make modifications to this embodiment without creative contribution as required after reading this specification, but as long as they are within the rights of the present invention All claims are protected by patent law.
[0023] ①. According to the silkworm baculovirus polyhedron gene sequence, design polh primer, primer design is as follows: upstream primer polh-F: AGGGATCCatgccgaattattcatac( underline Indicates BamHI restriction site) SEQ ID No.1; downstream primer polh-R:CC GAATTC atacgccggaccagtgaa (the underline indicates the EcoRI restriction site) SEQ ID No.2;
[0024] According to the genome DNA sequence of Escherichia coli JM109, the primers of Escherichia coli JM109 L-asparaginase Ⅱ gene (asp) were designed as follows: upstream primer asp-F: CG GGATCC ATGTTACCCAATATCACCAT (underlined BamHI restriction...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More