Supercharge Your Innovation With Domain-Expert AI Agents!

Recombinant virus and method for producing L-asparaginase II by using virus

An asparaginase and recombinant virus technology, applied in the field of biological science, can solve the problems of low production level, many separation and purification steps, etc., and achieve the effects of stable gene expression products, stable expression products and good safety.

Inactive Publication Date: 2011-09-14
HUZHOU ACAD OF AGRI SCI
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the production of L-asparaginase Ⅱ mostly adopts genetically engineered bacteria with Escherichia coli as the host, and there are two problems in production: low production level and numerous separation and purification steps.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0022] This specific embodiment is only an explanation of the present invention, and it is not a limitation of the present invention. Those skilled in the art can make modifications to this embodiment without creative contribution as required after reading this specification, but as long as they are within the rights of the present invention All claims are protected by patent law.

[0023] ①. According to the silkworm baculovirus polyhedron gene sequence, design polh primer, primer design is as follows: upstream primer polh-F: AGGGATCCatgccgaattattcatac( underline Indicates BamHI restriction site) SEQ ID No.1; downstream primer polh-R:CC GAATTC atacgccggaccagtgaa (the underline indicates the EcoRI restriction site) SEQ ID No.2;

[0024] According to the genome DNA sequence of Escherichia coli JM109, the primers of Escherichia coli JM109 L-asparaginase Ⅱ gene (asp) were designed as follows: upstream primer asp-F: CG GGATCC ATGTTACCCAATATCACCAT (underlined BamHI restriction...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant virus and method for producing L-asparaginase II by using the virus, which belong to the technical field of bioscience. The invention has the purpose of providing the recombinant virus. The virus comprises a polyhedrin gene and an L-asparaginase II gene. Therefore, the recombinant virus is transferred to a silkworm to produce the L-asparaginase II connected with the polyhedron by a covalent bond; and then the L-asparaginase II is separated and purified by a polyhedral body; the recombinant virus has the characteristic of high expression level in the silkworm body; and the L-asparaginase II separated and purified by the polyhedral body has the characteristic of high purity.

Description

technical field [0001] The invention relates to a recombinant plasmid, which belongs to the technical field of biological science. Background technique [0002] L-asparaginase II can specifically catalyze the hydrolysis of L-asparagine to generate L-aspartic acid and ammonia. It is an important protein anti-tumor drug, which is widely used clinically in the treatment of lymphoma and childhood acute lymphoblastic leukemia (ALL), and can also be used in the treatment of melanosarcoma, Hodgkinson's disease, pancreatic cancer and other diseases. At present, the production of L-asparaginase Ⅱ mostly adopts genetically engineered bacteria with Escherichia coli as the host, and there are two problems in the production: low production level and many separation and purification steps. Contents of the invention [0003] The object of the present invention provides a kind of recombinant virus, and this virus has polyhedron gene and L-asparaginase Ⅱ gene, therefore can produce the L-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/85C12N9/82C12R1/93C12R1/19
Inventor 费建明王文兵吴岩施国方占鹏飞
Owner HUZHOU ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More