Preparation method of recombinant carboxypeptidase b

A technology of carboxypeptidase and zymogen, which is applied in the field of preparation of recombinant carboxypeptidase B in yeast, can solve the problems of complex process steps and large liquid volume, and achieve the effect of increasing expression and small volume

Inactive Publication Date: 2011-12-21
GAN&LEE PHARMA
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the process steps of this method are very complicated: on the one hand, this method needs to be purified first after recombinant expression, and then to be digested, and then to be purified again after enzyme digestion; on the other hand, when this method is used for enzyme digestion, CPB With the flow through (Flow Through), the volume of the collected liquid is very large, and it needs to be concentrated before subsequent secondary purification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of recombinant carboxypeptidase b
  • Preparation method of recombinant carboxypeptidase b
  • Preparation method of recombinant carboxypeptidase b

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The structure of embodiment 1 recombinant CPB zymogen expression vector

[0041] 1. Provide the nucleotide sequence encoding the CPB zymogen-histidine tag: chemically synthesize the gene sequence encoding the CPB zymogen according to the codon preference of Pichia pastoris, and add 6 groups of codes at the 3' end of the gene sequence Amino acid codon, the final nucleotide sequence is the nucleotide sequence shown in SEQ ID NO:1.

[0042] 2. Using the above-mentioned synthetic nucleotide sequence as a template, and using the designed two primers as upstream and downstream primers, carry out PCR amplification, wherein,

[0043] The primer sequences are:

[0044] Upstream primers:

[0045] GGCGAATTCCATCACCACCATCATCACACTACTGGTCATTCTTACGAGAA

[0046] Downstream primers:

[0047] ATATAGCGGCCGCTTACAATGACCCAAAACGTAGTTA

[0048] The PCR system is:

[0049] Template (5ng / ul) 0.5ul,

[0050] Upstream primer Y-pro-cpb-F (10uM) 0.5uL,

[0051] Downstream primer Y-cpb-3Hi...

Embodiment 2

[0068] The construction of embodiment 2 recombinant CPB zymogen yeast engineering bacteria

[0069] According to the Pichia operation manual of Invitrogen Company, the linearized recombinant CPB zymogen expression vector was electrotransformed into GS115 Pichia competent cells. Then the transformed GS115 Pichia pastoris was spread on MD solid medium and incubated at 29°C for 3-4 days.

[0070] Pick transformants from the above MD solid medium, transfer them to 0.25mg / ml YPD G-418, 0.75mg / ml YPD G-418, 3mg / ml YPD G-418 solid medium, and culture at 29°C. To screen for high-copy transformants. After the high-copy transformant grows up, pick a single colony and inoculate it in 5ml MD liquid medium, and cultivate it at 29°C and 200rpm to produce a large amount of recombinant CPB zymogen expression engineering bacteria GS115-proCPB-3his.

Embodiment 3

[0071] Induced expression of embodiment 3 recombinant CPB zymogen expression engineering bacteria

[0072] Inoculate the above-mentioned engineered bacteria into 10ml of YPD liquid medium according to 2% inoculum amount, cultivate at 28°C, 200rpm. Cultivate until OD 600nm At about 8 o'clock, centrifuge, discard the supernatant, resuspend the bacteria with 1L BMMY liquid medium, put it in a 2L shake flask, fill one bottle for every 500ml bacterial solution, seal the bottle mouth with gauze, 28°C, 200rpm, add methanol Culture to 0.7% (V / V), and replenish methanol to 0.7% (V / V) every 24 hours until the induction is completed on the sixth day. The recombinant CPB zymogen is secreted and expressed into liquid medium.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for preparing recombinant carboxypeptidase B (CPB) in Pichia pastoris. This method has a high expression level, and the expression product CPB zymogen does not need to undergo denaturation and renaturation, and active CPB can be obtained after direct enzymatic digestion to remove the propeptide, and the subsequent purification steps are also simple and convenient. The prepared recombinant carboxypeptidase B can be used for industrial production of recombinant human insulin.

Description

technical field [0001] The invention relates to a method for preparing carboxypeptidase B, in particular to a method for preparing recombinant carboxypeptidase B in yeast. Background technique [0002] Carboxypeptidase B (CPB for short, EC3.4.17.2) is a zinc-containing exopeptidase that can specifically hydrolyze basic amino acids at the C-terminus of peptide chains, such as arginine and lysine acid or ornithine. Carboxypeptidase B contains 307 amino acid residues and a molecular weight of 35KDa. [0003] CPB is currently widely used in protein and peptide C-terminal amino acid sequencing, or for modification of C-terminal basic amino acid residues in proteins or peptides. It is also used in medicine to diagnose pancreatitis. In the field of genetic engineering, CPB has also been used more and more widely, especially in the production process of recombinant human insulin, CPB is one of the indispensable dual enzymes, and its specific activity and stability affect the acti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N15/81C12N9/48
Inventor彭毅张琪张婷婷王大梅
OwnerGAN&LEE PHARMA