Medicinal composition for treating diseases caused by enterovirus infections

An enterovirus and composition technology, applied in the field of biopharmaceuticals, can solve problems such as damage to cellular immune responses and side effects, and achieve the effect of reducing the risk of side effects and reducing dosage

Active Publication Date: 2012-01-11
BEIJING KAWIN TECH SHARE HLDG
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Because hand, foot and mouth disease often causes damage to the body's cellular immune response, the use of sufficient interferon can improve the body's cellular immunity. Interferon is known to affect various cellular functions, including DNA replication, RNA and protein in normal and abnormal cells Synthetic, and thus, the cytotoxic effects of interferon are not limited to virus-infected cells are also presented in normal healthy cells, therefore, during interferon therapy, especially when high doses are required, can produce undesired side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Medicinal composition for treating diseases caused by enterovirus infections
  • Medicinal composition for treating diseases caused by enterovirus infections
  • Medicinal composition for treating diseases caused by enterovirus infections

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Virus Propagation

[0024] Will 1X10 5 PFU of EV71 virus was inoculated on monolayer rhabdomyosarcoma cells (RD cells), added maintenance solution and placed in a 37°C, 5% CO2 incubator for 72 hours, and more than 90% of the lesions appeared. Store in a -80°C refrigerator for later use.

[0025] Will 1X10 5 The CoxA16 virus of PFU was inoculated in the culture bottle of single-layer cervical cancer cells (Hela cells), and more than 90% of the lesions appeared after being cultured in a 37°C, 5% CO2 incubator for 72 hours. Store in -80°C refrigerator for later use

Embodiment 2

[0026] Example 2 Toxicity Determination

[0027] The reserved EV71 virus and CoxA16 virus were respectively diluted 10-fold with maintenance solution (containing 2% newborn fetal bovine serum), repeated 3 wells vertically, and inoculated horizontally on the monolayer RD cells in the 96-well plate and in the 96-well plate respectively. On the monolayer Hela cells in the plate, culture at 37°C and 5% CO2, observe the lesions every day, aspirate and discard the liquid in the plate well after 96 hours, add 100 μl of 1% neutral red and stain at 37°C for 2 hours, discard the dye solution, and use The excess dye was fully eluted in the washing solution, and 100 μl of decolorizing solution was added, decolorized at room temperature for 10 minutes, and the OD value was measured with a microplate reader at a wavelength of 540 nm. Through calculation, the TCID50 of EV71 virus was 10-5.2, and the TCID50 of CoxA16 virus was 10-4.8.

Embodiment 3

[0028] Embodiment three virus detection

[0029] Viral RNA was extracted by the Trizol method, subpackaged and stored at -80°C in time, the viral VP1 gene fragment was amplified by RT-PCR, and the RT-PCR results were detected by agarose gel electrophoresis. According to the complete gene sequence of the international standard strain, and referring to the gene sequence of the local strain in Asia, use the software DNASTAR and Primer premier 5.0 to design the following primers: the upstream primer of EV71 virus: GCA GCC CAA AAG AAC TTC, the downstream primer: ATT TCAGCA GCT TGG AGTG , the target fragment is 226bp. CoxA16 virus upstream primer CCTATTGCAGACATGATTGAC, downstream primer TGTTGTTATCTTGTCTCTAC, target fragment 900bp.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a medicinal composition, which particularly consists of a first agent of an antiviral medicament and a second agent of an immunomodulator, wherein the first agent, which is prepared by blocking virus messenger ribose nucleic acid (mRNA) translation and inhibiting the synthesis of virus nucleic acid in a cell. The medicinal composition can be used for treating organic pathological changes caused by enterovirus infections, such as a hand, foot and mouth disease.

Description

technical field [0001] The present invention relates to a pharmaceutical composition for the treatment of diseases caused by enterovirus infection, in particular to a first-acting agent that blocks viral mRNA translation in cells, inhibits viral nucleic acid synthesis, and obtains cellular immunity by regulating the body's immune response. A medicinal composition composed of a second active agent belongs to the field of biopharmaceuticals. Background technique [0002] Hand-foot-mouth disease (Hand-food-mouth disease, HFMD) is a global infectious disease, which has been reported in most parts of the world. In 1957, the disease was first reported in New Zealand, from which coxsackie (Cox) virus was isolated. The found pathogen of HFMD is mainly Cox A 16 type. In 1972, the pathogen of HFMD was confirmed as enterovirus (enteric virus, EV) 71 in the United States. Since then, EV71 infection has alternated with CoxA16 infection, becoming the main pathogen of HFMD. Epidemiologi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K45/06A61K38/21A61K38/20A61P31/14A61P1/00
Inventor侯建华周德胜张春丽熊国裕
OwnerBEIJING KAWIN TECH SHARE HLDG