Unlock instant, AI-driven research and patent intelligence for your innovation.

Interferon alpha mutant and polyethylene glycol derivative thereof

A technology of polyethylene glycol and mutants, applied in the direction of interferon, cytokines/lymphokines/interferons, animal/human proteins, etc., can solve the problem of low activity, unsatisfactory free cysteine ​​residue sites, Difficulty in separation and purification

Active Publication Date: 2013-07-17
BEIJING TRI PRIME GENE PHARMA CO LTD
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The primary purpose of the present invention is to provide a cysteine ​​mutant of composite interferon, to solve the problem that there is no free cysteine ​​residue in the existing interferon alpha for modification by specific site thiol PEG modifiers or The unsatisfactory position of the free cysteine ​​residues or mutations will cause instability of protein molecules, low activity, difficulty in separation and purification, and it is not conducive to the modification of specific sites with PEG modifiers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Interferon alpha mutant and polyethylene glycol derivative thereof
  • Interferon alpha mutant and polyethylene glycol derivative thereof
  • Interferon alpha mutant and polyethylene glycol derivative thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1: Construction and sequence confirmation of engineering bacteria for the expression of the cysteine ​​mutant at position 56 of compound interferon

[0073] The plasmid of composite interferon was extracted as a template, and the first round of PCR included two reaction systems.

[0074] The primers of reaction system 1 are:

[0075] P1: ATGTGTGACCTGCCGCAGAC,

[0076] P4: CTATTAGTCTTTACGACGCAG,

[0077] Amplify the DNA sequence at position 56 and its upstream.

[0078] The primers of reaction system 2 are:

[0079] P2: CATTTCGTGCAGGCAAGAGATAGC,

[0080] P3: CTATTAGTCTTTACGACGCAG,

[0081] Amplify the DNA sequence at position 56 and its downstream.

[0082]The reaction conditions were: 94°C for 4 minutes, 94°C for 1 minute, then 55°C for 2 minutes, and 72°C for 2 minutes, a total of 30 cycles.

[0083] In the second round of PCR, the product of the first round of PCR was used as a template, and P1 and P2 were used as primers for PCR amplification. The rea...

Embodiment 2

[0088] Example 2: Fermentation, purification and detection of the cysteine ​​mutant at position 55 of compound interferon

[0089] The Escherichia coli engineering bacterium that obtains expressing compound interferon 55 position cysteine ​​mutants with the same method of principle as Example 1 is constructed, then selects single bacterium colony to be inoculated in the LB medium containing ampicillin ( Prepare with 10g of peptone, 5g of yeast powder, and 10g of NaCl per liter, adjust the pH to 7.0), culture in a shaker flask at 37°C and 220 rpm until OD 600nm It is 0.6-0.8. Then inoculate in the LB medium of 50L with 5% volume inoculum and carry out fermentation culture (every liter contains 0.1% ampicillin) in 80L fermenter, culture temperature is 37 ℃, regulates pH at 6.5 with ammonia water in the cultivation process Between -7.5, use the rotating speed to control the dissolved oxygen value between 3-5%. in OD 600nm After reaching 1.0, 10 g of IPTG was added at a mass vo...

Embodiment 3

[0095] Example 3: Fermentation, purification and detection of the cysteine ​​mutant at position 56 of compound interferon

[0096] The Escherichia coli engineered bacteria constructed by the method of Example 1 were activated and shake flask cultured according to the method of Example 2. Inoculate 140L of LB culture with a volume inoculum of 6% and carry out fermentation culture in a 200L fermenter, the conditions are as in Example 2, but the induction culture temperature is 36°C. After the induction culture time is over, put the tank at room temperature and centrifuge at 5000 rpm for 20 minutes to collect the bacteria, and the obtained bacteria are washed twice with the above-mentioned TE buffer to remove the main impurities in the fermentation broth.

[0097] Take 40 g of the bacteria obtained from the above treatment and add 600 ml of the above-mentioned TE buffer solution at a mass-to-volume ratio of 1:15, and then add lysozyme at a ratio of 100:1 to treat for more than 4 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of biomedicine and relates to consensus interferon cysteine mutant and polyethylene glycol derivative of the mutant, a preparation method and a drug combination of the polyethylene glycol derivative and application of the consensus interferon cysteine mutant and the polyethylene glycol derivative of the mutant to preparing drugs for treating viral diseases. The consensus interferon cysteine mutant is obtained through mutating amino acid at one of 55-57 positions counting from N terminal in consensus interferon amino acid sequence; the polyethylene glycol derivative of the consensus interferon cysteine mutant is obtained through connecting the consensus interferon cysteine mutant with polyethylene glycol modifier; and the molecular weight of the polyethylene glycol modifier is between 5-40KDa. The consensus interferon cysteine mutant and the polyethylene glycol derivative of the mutant, disclosed by the invention, have the advantages of higher biological activity, better pharmacological effect and stability and more reliable safety.

Description

technical field [0001] The present invention generally relates to interferon alpha mutants, polyethylene glycol derivatives thereof, preparation methods of the latter, pharmaceutical compositions and their use in the preparation of medicines for treating viral diseases, and in particular to compound interferon half A cystine mutant, its polyethylene glycol derivative, a preparation method of the latter, a pharmaceutical composition and the use of the two in the preparation of medicines for treating viral diseases. Background technique [0002] Interferon (interferon, IFN) is a kind of cytokine drug with broad-spectrum antiviral effect originally produced by the animal body. According to its production site and mechanism of action, it can be divided into α, β, γ, and λ types , and each large type can be divided into several small subtypes. Different subtypes in the same large type have little difference in primary structure, and are very similar in secondary and higher-level ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/56C07K17/08A61K38/21A61K47/48A61P31/12
Inventor 周敏毅刘金毅程永庆
Owner BEIJING TRI PRIME GENE PHARMA CO LTD