Interferon alpha mutant and polyethylene glycol derivative thereof
A technology of polyethylene glycol and mutants, applied in the direction of interferon, cytokines/lymphokines/interferons, animal/human proteins, etc., can solve the problem of low activity, unsatisfactory free cysteine residue sites, Difficulty in separation and purification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0072] Example 1: Construction and sequence confirmation of engineering bacteria for the expression of the cysteine mutant at position 56 of compound interferon
[0073] The plasmid of composite interferon was extracted as a template, and the first round of PCR included two reaction systems.
[0074] The primers of reaction system 1 are:
[0075] P1: ATGTGTGACCTGCCGCAGAC,
[0076] P4: CTATTAGTCTTTACGACGCAG,
[0077] Amplify the DNA sequence at position 56 and its upstream.
[0078] The primers of reaction system 2 are:
[0079] P2: CATTTCGTGCAGGCAAGAGATAGC,
[0080] P3: CTATTAGTCTTTACGACGCAG,
[0081] Amplify the DNA sequence at position 56 and its downstream.
[0082]The reaction conditions were: 94°C for 4 minutes, 94°C for 1 minute, then 55°C for 2 minutes, and 72°C for 2 minutes, a total of 30 cycles.
[0083] In the second round of PCR, the product of the first round of PCR was used as a template, and P1 and P2 were used as primers for PCR amplification. The rea...
Embodiment 2
[0088] Example 2: Fermentation, purification and detection of the cysteine mutant at position 55 of compound interferon
[0089] The Escherichia coli engineering bacterium that obtains expressing compound interferon 55 position cysteine mutants with the same method of principle as Example 1 is constructed, then selects single bacterium colony to be inoculated in the LB medium containing ampicillin ( Prepare with 10g of peptone, 5g of yeast powder, and 10g of NaCl per liter, adjust the pH to 7.0), culture in a shaker flask at 37°C and 220 rpm until OD 600nm It is 0.6-0.8. Then inoculate in the LB medium of 50L with 5% volume inoculum and carry out fermentation culture (every liter contains 0.1% ampicillin) in 80L fermenter, culture temperature is 37 ℃, regulates pH at 6.5 with ammonia water in the cultivation process Between -7.5, use the rotating speed to control the dissolved oxygen value between 3-5%. in OD 600nm After reaching 1.0, 10 g of IPTG was added at a mass vo...
Embodiment 3
[0095] Example 3: Fermentation, purification and detection of the cysteine mutant at position 56 of compound interferon
[0096] The Escherichia coli engineered bacteria constructed by the method of Example 1 were activated and shake flask cultured according to the method of Example 2. Inoculate 140L of LB culture with a volume inoculum of 6% and carry out fermentation culture in a 200L fermenter, the conditions are as in Example 2, but the induction culture temperature is 36°C. After the induction culture time is over, put the tank at room temperature and centrifuge at 5000 rpm for 20 minutes to collect the bacteria, and the obtained bacteria are washed twice with the above-mentioned TE buffer to remove the main impurities in the fermentation broth.
[0097] Take 40 g of the bacteria obtained from the above treatment and add 600 ml of the above-mentioned TE buffer solution at a mass-to-volume ratio of 1:15, and then add lysozyme at a ratio of 100:1 to treat for more than 4 ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 