Unlock instant, AI-driven research and patent intelligence for your innovation.

Engineering bacteria for expressing L-lactate dehydrogenase subjected to orthogenetic evolution and application thereof

A technology of lactate dehydrogenase and directed evolution is applied in the application field of splitting racemic mandelic acid and producing R-mandelic acid and acetophenone acid, and achieves the effects of short growth cycle, low cost and obvious effect.

Active Publication Date: 2013-06-19
上海肆芃科技有限公司
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] After searching, there is no report on the method of producing R-mandelic acid and acetophenone acid using the whole cell catalyst of the engineered strain exogenously expressing mutant L-iLDH

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria for expressing L-lactate dehydrogenase subjected to orthogenetic evolution and application thereof
  • Engineering bacteria for expressing L-lactate dehydrogenase subjected to orthogenetic evolution and application thereof
  • Engineering bacteria for expressing L-lactate dehydrogenase subjected to orthogenetic evolution and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Construction of engineered bacteria expressing directed evolution L-lactate dehydrogenase

[0051] (1) Prepare the genomic DNA of Pseudomonas stutzeri (Pseudomonas stutzeri SDM, CCTCC No. M206010) by conventional methods. For this process, please refer to the bacterial genome in the "Guide to Refined Molecular Biology" published by Science Press. Method of quantity preparation. Using PCR reaction, the gene encoding L-iLDH was amplified from the genome of Pseudomonas stutzeri SDM.

[0052] The PCR reaction program is:

[0053] a. 95℃ pre-denaturation for 10 minutes

[0054] b. Denaturation at 95°C for 30 seconds

[0055] c. Annealing at 60℃ for 30 seconds

[0056] d. 72℃ extension for 1 minute

[0057] Repeat the process b-d 30 cycles

[0058] e. Supplementary extension for 10 minutes

[0059] The primers used are:

[0060] Upstream primer lldU: AAGCTTATGATTTCCGCCTCTACC, containing HindIII restriction site

[0061] Downstream primer lldD: CTCGAGTCAGACGTCAGCAGACGTTG, contain...

Embodiment 2

[0085] Example 2: Application of highly expressed mutant L-iLDH engineered Escherichia coli in the resolution of racemic mandelic acid

[0086] (1) Preparation of complete E. coli cells expressing mutant L-iLDH:

[0087] Plate culture: Streak the E. coli C43(DE3) strain containing pETDuet-1-mlldD vector into solid LB medium. The medium contains ampicillin at a concentration of 1 mg / ml. Cultivate for 12 hours at 37°C. Take a single colony;

[0088] Seed culture: inoculate the picked single colony into 5 ml liquid LB medium, the medium contains ampicillin at a concentration of 1 mg / ml, and culture it at 37°C for 10 hours;

[0089] Preparation of high-expressing mutant L-iLDH whole-cell catalyst: transfer the seeds to 1 liter LB medium (as for a 5-liter Erlenmeyer flask) at 1% inoculum, and cultivate at 37°C to OD 620nm When it reaches 0.6, isopropylthiogalactoside (IPTG) with a final concentration of 1 mmol / L is added to induce the expression of the mutant protein. After 6 hours of i...

Embodiment 3

[0092] Example 3: Application of highly expressed mutant L-iLDH engineered Escherichia coli in the resolution of racemic mandelic acid

[0093] (1) Preparation of complete E. coli cells expressing mutant L-iLDH:

[0094] Plate culture: Streak the E. coli C43(DE3) strain containing pETDuet-1-mlldD vector into solid LB medium. The medium contains ampicillin at a concentration of 1 mg / ml. Cultivate for 12 hours at 37°C. Take a single colony;

[0095] Seed culture: inoculate the picked single colony into 5 ml of liquid LB medium, the medium contains ampicillin at a concentration of 1 mg / ml, cultured at 37°C for 8 hours;

[0096] Preparation of high-expressing mutant L-iLDH whole-cell catalyst: transfer the seeds to 1 liter LB medium (as for a 5-liter Erlenmeyer flask) at 1% inoculum, and cultivate at 37°C to OD 620nm When it reaches 0.5, isopropylthiogalactoside (IPTG) with a final concentration of 1.2 mmol / L is added to induce the expression of the mutant protein. After induction at 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses engineering bacteria for expressing L-lactate dehydrogenase subjected to orthogenetic evolution, which is engineering escherichia coli capable of heterologously expressing NAD (Nicotinamide Adenine Dinucleotide) independent L-lactate dehydrogenase subjected to orthogenetic evolution. The engineering bacteria can highly express corresponding mutant protein on the basis of commercial escherichia coli C43 (DE3) and through transporting an expression vector pETDuet-1-mlldD containing the mutant NAD independent L-lactate dehydrogenase, and has the S-mandelic acid degrading activity. The invention also discloses an application of the engineering bacteria in the resolution of racemic mandelic acid. The racemic mandelic acid is conducted through taking intact cells of the constructed engineering bacteria as a catalyst, and meanwhile, homochiral R-mandelic acid and benzoyl formic acid are produced. The engineering bacteria has the advantages of high substrate utilization rate, high product concentration, high optical purity, simplicity and convenience in future extraction, and the like.

Description

Technical field [0001] The present invention relates to an engineered Escherichia coli bacteria and applications, in particular to an engineered Escherichia coli capable of exogenously expressing directed evolution NAD (nicotinamide adenine dinucleotide) independent L-lactate dehydrogenase, and said The application of engineering bacteria in the resolution of racemic mandelic acid and the co-production of R-mandelic acid and acetophenone acid. Background technique [0002] R-mandelic acid and its derivatives are important intermediates in fine chemicals and the synthesis of many drugs. High purity chiral R-mandelic acid can be used to synthesize semi-synthetic penicillins, cephalosporins, anti-cancer antibiotics and anti-obesity drugs "Preparation of(R)-(-)-mandelic acid and its derivatives from racemates by enantioselective degradation with anewly isolated bacterial strain Alcaligenes sp.ECU0401.Bioprocess.Biosyst.Eng.2008,31:445-451.". R-mandelic acid can also be used as an a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12R1/19
Inventor 许平姜天翼高超马翠卿
Owner 上海肆芃科技有限公司