Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cryptosporidium andersoni nucleic acid vaccine with cross protection and preparation method of vaccine

A cryptosporidium and nucleic acid vaccine technology, applied in botany equipment and methods, biochemical equipment and methods, pharmaceutical formulations, etc., to achieve high antibody titer and good effect on preventing animal cryptosporidiosis

Inactive Publication Date: 2012-07-25
JILIN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are 10 species of Cryptosporidium that can infect humans at home and abroad, but the research on the cross-protection of Cryptosporidium is still blank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cryptosporidium andersoni nucleic acid vaccine with cross protection and preparation method of vaccine
  • Cryptosporidium andersoni nucleic acid vaccine with cross protection and preparation method of vaccine
  • Cryptosporidium andersoni nucleic acid vaccine with cross protection and preparation method of vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Preparation of Cross-Protective Nucleic Acid Vaccine against Cryptosporidium amnesii

[0014] In the present invention, the cryptosporidium anthrai cyst wall protein coding gene AB is taken as an example to construct a recombinant eukaryotic expression vector. First, the target gene AB is connected to the T vector, and the BamHI , Xhol Carry out double enzyme digestion reaction, recover fragments and process BamHI and Xhol The eukaryotic expression vector pVAX1 of the double enzyme digestion reaction was ligated to construct the pVAX1-AB recombinant vector.

[0015] Concrete preparation steps are as follows:

[0016] According to the open reading frame of the cyst wall protein gene sequence of Cryptosporidium ansei and the physical map of the eukaryotic expression vector pVAX1, primers were designed and enzyme cutting sites were introduced.

[0017] AB upstream primer QF: 5'—CCGGGATCCGCCGCCACCATGTTTACATTTTCAGGGAAGC— 3'; wherein the 5' end contains BamHI sit...

Embodiment 2

[0021] Validation of Expression of Recombinant Nucleic Acid Vaccine in Eukaryotic Cells

[0022] Extract the recombinant plasmid pVAX1-AB, and use the plasmid purification kit to purify the plasmid at 37°C, 5% CO 2 Hela cells were cultured in an incubator until the cells reached 50%-80% confluence, and transfected according to the instructions of the Lipofectamine transfection kit. After 72 hours of transfection, the medium was changed and G418 was used for screening. At the same time, cells without transfection were used as a control . When the control cells were mostly dead, selection was maintained with media containing low concentrations of G418. One week later, positive clones were formed, and they were transferred and expanded for culture after they gradually increased. The culture supernatant, transfected cells and control cells were collected separately. Immunofluorescence and Western blotting identification after gene transfection (see attached image 3 , 4 sho...

Embodiment 3

[0024] Identification of Immune Efficacy of Cross-protective Nucleic Acid Vaccine against Cryptosporidium Angleri

[0025] Divide 30 4-6 weeks old, 18-22g female clean BALB / c mice into 3 groups, 10 in each group, the first group is pVAX1-AB intramuscular injection group (the adjuvant is styrol, 100ug / rat), the second group is the negative control group (intramuscular injection of 100ul / rat with PBS solution), the third group is the pVAX1 intramuscular injection group (adjuvant is styrol, 100ug / rat). Each group received three injections, two weeks apart. Before each immunization, the blood was collected from the tail vein, the serum was separated, and the Cryptosporidium parvum oocyst antigen was used as the coating antigen, and the IgG changes in the mouse serum were detected by indirect ELISA method (see attached Figure 5 shown). One week after the third immunization, 4 mice in each group were randomly sacrificed by bloodletting, the spleen was taken, added 2 mL of PBS...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a cryptosporidium andersoni nucleic acid vaccine with cross protection and a preparation method of the vaccine. The preparation method is characterized in that eukaryotic expression plasmid pVAX1 serves as a carrier, and capsule protein-coding genes with higher homology of cryptosporidium andersoni and cryptosporidium parvum are directionally inserted into multiple cloning sites of the eukaryotic expression carrier pVAX1, thus obtaining the cryptosporidium andersoni nucleic acid vaccine with cross protection. The cryptosporidium andersoni nucleic acid vaccine can not only generate immune response to resist the cryptosporidium andersoni, but also play a role of immunoprotection on the cryptosporidium parvum, thus realizing the aim of preventing animal cryptosporidiosis better.

Description

technical field [0001] The invention relates to a cross-protective nucleic acid vaccine against Cryptosporidium anseri and a preparation method thereof, in particular to a nucleic acid vaccine with protection against Cryptosporidium and Cryptosporidium parvum, which is used for the treatment of cryptosporidiosis The prevention and treatment belong to the technical field of parasite vaccine preparation. Background technique [0002] Cryptosporidium is a single-cell parasitic protozoa, which widely parasitizes the edge of the microvilli of the gastrointestinal epithelial cells of vertebrates, and can cause severe diarrhea, dehydration and anorexia in the host, resulting in serious economic losses. The disease caused by Cryptosporidium is called cryptosporidiosis, and this disease has threatened human life as an important pathogen, especially children, the elderly and immunocompromised patients. Although scholars at home and abroad have studied the disease for many years, so f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61K39/002A61P33/02C12N15/30C12N15/85
CPCY02A50/30
Inventor 宫鹏涛郑君张西臣李建华张楠高江明李赫吕强张国才杨举
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com