Unlock instant, AI-driven research and patent intelligence for your innovation.

Brassica napus BnCP51 promoter as well as preparation method and application of promoter

A cabbage rape and promoter technology is applied in the field of plant genetic engineering and biology, and can solve the problems of unsuitable production practice, unfavorable normal growth of plants, harmful ecological environment and the like

Active Publication Date: 2012-08-15
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the application of inducible promoters also has certain limitations. The external condition treatment of recipient plants, such as heat shock, hormone treatment, etc., may cause a series of physiological and biochemical reactions in the organism, which is not conducive to the normal growth of plants.
In addition, methylcortisol (dex, dexamethasone), estradiol (estradiol) and tetracycline (tetracycline) used as inducers in the chemical regulation system are all harmful to the ecological environment and should not be used in production practice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brassica napus BnCP51 promoter as well as preparation method and application of promoter
  • Brassica napus BnCP51 promoter as well as preparation method and application of promoter
  • Brassica napus BnCP51 promoter as well as preparation method and application of promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Rapeseed P BnCP51 Expression pattern analysis of driven endogenous genes:

[0069] The rapeseed used in the present invention is Brassica napus L. . The test materials were sown in the field and managed normally.

[0070] Take roots, stems, leaves, flower buds, and siliques from fertile plants with the same growth conditions in the field. Take at least three replicates of each material, and at least one plant for each replicate. After sampling, wrap them in tin foil and place them in liquid nitrogen immediately. medium, stored at -80°C. RNA was extracted (method described above). The fluorescent quantitative PCR instrument was IQ5 (Bio-Rad Company), and rape Actin (accession number AF111812) was used as the internal standard gene. The Actin gene primers were forward primer 5′-CTGGAATTGCTGACCGTATGAG-3′ and reverse primer 5′-ATCTGTTGGAAAGTGCTGAGGG-3′. Rapeseed P BnCP51 The driven endogenous gene primers are 5'AGGACTCAAGGTGCTGTGACTCCTAT3' and 5'CTGAGAGAGACACTAAATTCCCT...

Embodiment 2

[0074] A brassica napus promoter P BnCP51 The preparation method of promoter, its step is:

[0075] 1. Rapeseed promoter P BnCP51 The primer sequence:

[0076] According to the upstream 2kb sequence of the BnCP51 gene obtained from rapeseed whole genome sequencing, a pair of primers were designed for PCR amplification. 3'.

[0077] 2. Preparation of rapeseed promoter PBnCP51:

[0078] Utilize the SDS lysis method (described above) to extract the genomic DNA of rapeseed leaves, and use this as a template to carry out PCR amplification. The steps are: extract 25 μl of genomic DNA, and use this as a template to amplify. The reaction system is 50 μl, and 10×Ex Taq buffer 5 μl, dNTP 4 μl, 5’ primer 1 μl, 3’ primer 1 μl, ExTaq 0.5 μl, DNA template 1 μl about 100ng, ddH 2 O 37.5 μl. The primers used in PCR were designed according to the upstream 2kb sequence of BnCP51 gene obtained by whole genome sequencing of rapeseed: PBnCP51S: 5′-(KpnI)CGGGGTACCGGTAAAATCTCTTGTAGCCCGT-3′ and...

Embodiment 3

[0082] pBI-P BnCP51 Arabidopsis transformation and PCR detection:

[0083] Arabidopsis thaliana was transformed by the inflorescence infection method (Zhang X R. et al. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nature, 2006, 1:1-6). It was grown on the MS (mentioned above) medium containing 50 mg / L kanamycin, and the green shoots obtained were preliminarily considered to be transformed plants. After the transformed plant grew two true leaves, it was transplanted into vermiculite. After the plant appeared inflorescence, a true leaf was taken to extract genomic DNA (described above) by SDS method for PCR identification. The primer sequences are NPT II F: 5′GATGGATTGCACGCAGGT3′ and NPT II R: 5′-TCAGAAGAACTCGTCAAG-3′; the PCR reaction system is as follows: template DNA 1μL (about 100ng), 10×Taq buffer (containing MgCl 2 ) 1 μl, 1.5mmol / L dNTP (10mmol / L) 1μl, 5’ primer (10μmol / L) 0.5μl, 3’ primer (10μmol / L) 0.5μl, Taq (5U / μl) 0.5μl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a brassica napus BnCP51 promoter as well as a preparation method and an application of the promoter. The preparation method comprises the following steps of: performing polymerase chain reaction (PCR) on the basis of a primer designed according to a BnCP51 gene upstream 2kb sequence obtained from the all genomic sequencing of brassica napus, thus obtaining the sequence of a 5' upstream promoter of the brassica napus BnCP51; and designing a primer according to the 5' upstream 2kb sequence of the BnCP51 obtained from the all genomic sequencing of the brassica napus, extracting genomic DNA of brassica napus leaves, performing PCR amplification on the genomic DNA, connecting the genomic DNA with a pMD18-T carrier after performing purification and recovery, transformingcompetent cells, picking positive clone, and sequencing after PCR positive detection and digestion verification, thus obtaining the upstream 2kb flanking sequence of target genes, namely PBnCP51. Dueto the efficient expression of the PBnCP51 in rape anther and pollen grains, the expression efficiency of foreign genes in transgenic plants is improved, thus the PBnCP51 can be used in the gene engineering study of the plants and in the transgenic safety study of seed rape.

Description

technical field [0001] The invention relates to the fields of plant genetic engineering and biotechnology, in particular to a BnCP51 gene promoter of Brassica napus (named P BnCP51 , the same below), and also relates to a method for preparing the Brassica napus BnCP51 promoter. The present invention also relates to the vector containing the promoter or its substantially homologous nucleotide sequence and the application of the promoter in genetic engineering of rapeseed and other plants. Background technique [0002] A plant gene promoter is a DNA sequence located in the upstream region of the 5' end of a structural gene and contains cis-acting elements. It determines the specificity, direction and efficiency of downstream gene transcription, and is the most critical factor in gene transcription regulation mechanism and expression mode. . In addition, the expression of exogenous genes in plant cells is the key to plant genetic engineering research, and the expression of ex...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/63C12N15/10A01H5/00
Inventor 刘胜毅阳永学董彩华刘婷婷黄军艳李振波刘越英
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI