Brassica napus p17673 promoter and its preparation method and application

A technology of Brassica napus, bn17673, applied in the field of plant genetic engineering and biology, can solve problems such as unsuitable production practice, unfavorable normal plant growth, and harmful ecological environment

Active Publication Date: 2015-08-12
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the application of inducible promoters also has certain limitations. The external condition treatment of recipient plants, such as heat shock, hormone treatment, etc., may cause a series of physiological and biochemical reactions in the organism, which is not conducive to the normal growth of plants.
In addition, methyl dehydrocortisol (dex, dexamethasone), estradiol (estradiol) and tetracycline (tetracycline) used as inducers in the chemical regulation system are harmful to the ecological environment and should not be used in production practice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brassica napus p17673 promoter and its preparation method and application
  • Brassica napus p17673 promoter and its preparation method and application
  • Brassica napus p17673 promoter and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] anther specific expression gene Bn17673 and promoter P17673 predictions:

[0073] The used rapeseed of the present invention is Brassica napus Zhongshuang No. 11 (mentioned above). The test materials were sown in the field and managed normally. Eleven tissues including roots, stems, leaves, flower buds, ovules, siliques, silique peels, stamens, pistils, sepals and petals were obtained from rapeseed plants grown under field growth conditions. Take at least three replicates of each material, and each replicate has at least one plant. After sampling, wrap it in tin foil, quickly place it in liquid nitrogen quick-freezing, and store it at -80°C. RNA was extracted using the Trirol extraction kit (described above) according to the requirements of the kit. The extracted RNA was sent to Shenzhen BGI Institute for reverse transcription, library construction, and transcriptome sequencing using the solexa sequencing technology (described above). The amount of sequencing data f...

Embodiment 2

[0075] rape P17673 Expression pattern analysis of driven endogenous genes:

[0076] The test materials were sown in the field and managed normally. Get roots, stems, leaves, flower buds, siliques, pistils, stamens, and petals from the rapeseed Zhongshuang No. 11 (as described above) plant grown under field growth conditions. Take at least three replicates of each material, and each replicate has at least one plant. After sampling, wrap it in tin foil, place it quickly in liquid nitrogen, and store it at -80°C. Extract RNA (method described above). Fluorescent quantitative PCR instrument is IQ5 (Bio-Rad Company), using rapeseed Actin (accession number AF111812) as an internal standard gene, Actin Gene primers were forward primer 5'-CTGGAATTGCTGACCGTATGAG-3' and reverse primer 5'-ATCTGTTGGAAAGTGCTGAGGG-3'. Endogenous genes driven by P17673 Bn17673 The primers were 5' ACAAATACTTGGTCCCACGAGA 3' and 5' ACCCGTTTGAGGAAGTGTGTTA 3'. The fluorescent quantitative PCR reaction s...

Embodiment 3

[0080] A Brassica napus promoter P17673 The preparation method of promoter, its step is:

[0081] 1. Rapeseed promoter P17673 Primer sequences:

[0082] Based on the whole genome sequencing of rapeseed Bn17673 The upstream 2.2kb sequence of the gene was designed with 1 pair of primers for PCR amplification. The primers used were P17673S: 5'- AGAAGACGATGGCGTCAATGT -3' and P17673A: 5'- AATCACACGACCGATCAATATAAAA -3'.

[0083] 2. Preparation of rapeseed promoter P17673:

[0084] Use the SDS lysis method (described above) to extract genomic DNA from rapeseed leaves, and use this as a template for PCR amplification. The steps are: extract 25 μl of genomic DNA, and use this as a template for amplification. The reaction system is 50 μl, and 10× Ex Taq buffer 5 μl, dNTP 4 μl, 5’ primer 1 μl, 3’ primer 1 μl, ExTaq 0.5 μl, DNA template 1 μl about 100ng, ddH 2 O 37.5 μl. Based on the whole genome sequencing of rapeseed Bn17673 The primers used for PCR design of the upstream 2.2kb s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Brassica napus promoter P17673 and a preparation method and application thereof. The method comprises the steps: (1) designing a pair of primers according to an upstream 2.2kb sequence of a gene Bn17673 which is obtained through sequencing all genomes of napus, and carrying out PCR (Polymerase Chain Reaction) amplification, so as to obtain a 5' upstream promoter sequence of the napus Bn17673; (2) preparing the napus promoter P17673: extracting genomic DNA (Deoxyribonucleic Acid) of napus leaves, carrying out PCR amplification with the primers, purifying and recovering with a gel recovery kit, then, connecting to a pMD18-T vector, picking positive clones, carrying out PCR positive detection and enzyme digestion verification, and then, sequencing, thereby obtaining an upstream 2.2kb flanking sequence of a target gene, wherein shown by bioinformatics analysis, the upstream flanking sequence is P17673. Shown by fluorescent quantitative PCR and GUS (glucuronidase) staining results, P17673 is efficiently expressed in the anthers and pollen of napus and is not expressed in tissues, such as roots, stems, leaves, fruits, seeds and the like. The promoter has good application potential to the safety of transgenic napus edible oil and the aspects of improving crop quality, artificially creating germplasm resources and the like.

Description

technical field [0001] The invention relates to the fields of plant genetic engineering and biotechnology, in particular to a brassica napus Bn17673 The gene promoter (named as P17673, hereinafter the same), also relates to a preparation method of Brassica napus P17673 promoter. The present invention also relates to the vector containing the promoter or its substantially homologous nucleotide sequence and the application of the promoter in rapeseed and Arabidopsis. Background technique [0002] A plant gene promoter is a DNA sequence located in the upstream region of the 5' end of a structural gene and contains cis-acting elements. It determines the specificity, direction and efficiency of downstream gene transcription, and is the most critical factor in gene transcription regulation mechanism and expression mode. . In addition, the expression of exogenous genes in plant cells is the key to plant genetic engineering research, and the expression of exogenous genes first dep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/10C12N15/84A01H5/02
Inventor刘胜毅董彩华黄军艳程晓辉童超波于景印刘越英
OwnerINST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI