Method for quickly identifying Brucella based on mass spectrum technology and application thereof

A technology of Brucella and Brucella nucleic acid, applied in the biological field, can solve problems such as staying and achieve the effect of high sensitivity

Active Publication Date: 2013-01-02
BIOYONG TECH
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method still stays on the analysis of the characteristic protein of Brucella, and does not involve how to establish a Brucella-related nucleic acid mass spectrometry feature library and use the library for bacterial identification and typing, so it cannot solve the above-mentioned problems. question

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly identifying Brucella based on mass spectrum technology and application thereof
  • Method for quickly identifying Brucella based on mass spectrum technology and application thereof
  • Method for quickly identifying Brucella based on mass spectrum technology and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Example 1: The establishment of the nucleic acid fingerprint of Brucella melis

[0070] 1. Design and select appropriate primers

[0071] According to the 16S gene sequence of sheep Brucella (Brucella melitensis), design PCR primers, respectively:

[0072] SEQ ID No: 1

5-cagtaatacgactcactatagggagaaggctAGAGTTTGATCCTGGCTCAG-3 (SEQ ID No: 1)

SEQ ID No: 2

5-aggaagagagCTGCTGCGTCCCGTAG-3 (SEQ ID No: 2)

[0073] The sequences AGAGTTTGATCCTGGCTCAG and CTGCTGCGTCCCGTAG respectively match the target region, and cagtaatacgactcactatagggagaaggct and aggaagagag are additional sequences added to the upstream and downstream PCR primers to ensure that the 5' end of the primer of SEQ ID No: 1 contains a 31bp tag (cagtaatacgactcactatagggagaaggct ), the 5' end of the primer of SEQ ID No: 2 contains a 10bp tag (aggaagagag).

[0074] Relevant primers were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.

[0075] 2. Universal Primer Amplification

...

Embodiment 2

[0102] Example 2. Using the established bacterial nucleic acid fingerprint feature library to detect dairy products to be inspected

[0103] Divide the fresh milk sample to be tested into two after appropriate dilution, and use the following method to test sample 1:

[0104] 1. Extract bacterial chromosomal DNA from milk samples with the optimized CTAB-NaCl method. The specific steps are as follows:

[0105] (1) Take 1.5mL fresh milk sample, centrifuge at 10,000r / min for 10min, and discard the supernatant;

[0106] (2) Suspend the precipitate to 400 μL with NET solution (50 mM NaCl, 125 mM EDTA, 50 mM Tris-HCl, pH7.6), add 200 μL of 10% (w / v) SDS solution to a final concentration of 3.4% (w / v), and set 80°C water bath for 10 minutes, cooling on ice for 3 minutes;

[0107] (3) Add 3 μL of proteinase K (200 mg / mL) and RNaseA (200 mg / mL) to a final concentration of 1 mg / mL, and bathe in water at 50 °C for 2 h;

[0108] (4) Add 100 μL of 5M NaCl solution, mix well and add 300 μ...

Embodiment 3

[0120] Embodiment 3: Biochemical analysis control experiment of sample 1 to be tested

[0121] Serum glucose agar medium SDA was prepared according to the standard method, and penicillin or cephalosporin (100 μg / 100ml) was added.

[0122] Select the fresh milk sample to be tested, draw 0.5ml sample, spread it on the pre-prepared antibiotic SDA petri dish in a sterile environment, cultivate it at 37°C for 3 days, and observe the growth of the colony. The results are as follows: Figure 4 shown.

[0123] Image 6 It was shown that wet, shiny, colorless, transparent, round, raised surface and small colonies with neat edges were formed in the petri dish. As a parallel test, 0.5ml of pasteurized fresh milk sample was selected as a control, and no colonies were formed after being cultured on SDA medium for 3 days. Therefore, the colonies in the antibiotic SDA medium were suspected to be Brucella bovis.

[0124] In order to further identify the suspected colony, the fresh milk sa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for quickly identifying Brucella based on a mass spectrum technology and application thereof. The invention discloses a method for quickly identifying Brucella, which comprises the steps of PCR (polymerase chain reaction) amplification, SAP (serum alkaline phosphatase) digestion, transcription, nucleic acid enzyme cutting, purification, detection with a mass spectrometer and the like. Based on the method, a common Brucella nucleic acid fingerprint database is established. According to a peak mass spectrogram generated in experiments, Brucella in a sample to be detected can be classified and identified, and the results can be widely used in the fields of Brucella typing and classification, environmental health and public safety quarantine and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for preparing Brucella nucleic acid fingerprints, and a method for rapidly identifying Brucella by using the method. Background technique [0002] Brucellosis, also known as Mediterranean relaxation fever, Maltese fever, wave fever or undulating fever, is a zoonotic systemic infectious disease caused by Brucella, mainly through the skin, mucous membranes, digestive tract and respiratory tract. Infection, especially the infection with Brucella melis and Brucella bovis is the most serious. Brucella suis infection is rare in humans, Brucella canis infection is rare, and Brucella sheep epididymis and Brucella sarira basically do not infect humans. Its clinical features are long-term fever, hyperhidrosis, arthralgia, and hepatosplenomegaly. In 1886, British military doctor Bruce isolated "Brucelia" from the spleen of a soldier who died of "Maltese fever" on the island of Malta, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12R1/01
Inventor马庆伟赵洪斌张海燕赵艳梅
OwnerBIOYONG TECH