Method for quickly identifying Brucella based on mass spectrum technology and application thereof
A technology of Brucella and Brucella nucleic acid, applied in the biological field, can solve problems such as staying and achieve the effect of high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] Example 1: The establishment of the nucleic acid fingerprint of Brucella melis
[0070] 1. Design and select appropriate primers
[0071] According to the 16S gene sequence of sheep Brucella (Brucella melitensis), design PCR primers, respectively:
[0072] SEQ ID No: 1
5-cagtaatacgactcactatagggagaaggctAGAGTTTGATCCTGGCTCAG-3 (SEQ ID No: 1)
SEQ ID No: 2
5-aggaagagagCTGCTGCGTCCCGTAG-3 (SEQ ID No: 2)
[0073] The sequences AGAGTTTGATCCTGGCTCAG and CTGCTGCGTCCCGTAG respectively match the target region, and cagtaatacgactcactatagggagaaggct and aggaagagag are additional sequences added to the upstream and downstream PCR primers to ensure that the 5' end of the primer of SEQ ID No: 1 contains a 31bp tag (cagtaatacgactcactatagggagaaggct ), the 5' end of the primer of SEQ ID No: 2 contains a 10bp tag (aggaagagag).
[0074] Relevant primers were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.
[0075] 2. Universal Primer Amplification
...
Embodiment 2
[0102] Example 2. Using the established bacterial nucleic acid fingerprint feature library to detect dairy products to be inspected
[0103] Divide the fresh milk sample to be tested into two after appropriate dilution, and use the following method to test sample 1:
[0104] 1. Extract bacterial chromosomal DNA from milk samples with the optimized CTAB-NaCl method. The specific steps are as follows:
[0105] (1) Take 1.5mL fresh milk sample, centrifuge at 10,000r / min for 10min, and discard the supernatant;
[0106] (2) Suspend the precipitate to 400 μL with NET solution (50 mM NaCl, 125 mM EDTA, 50 mM Tris-HCl, pH7.6), add 200 μL of 10% (w / v) SDS solution to a final concentration of 3.4% (w / v), and set 80°C water bath for 10 minutes, cooling on ice for 3 minutes;
[0107] (3) Add 3 μL of proteinase K (200 mg / mL) and RNaseA (200 mg / mL) to a final concentration of 1 mg / mL, and bathe in water at 50 °C for 2 h;
[0108] (4) Add 100 μL of 5M NaCl solution, mix well and add 300 μ...
Embodiment 3
[0120] Embodiment 3: Biochemical analysis control experiment of sample 1 to be tested
[0121] Serum glucose agar medium SDA was prepared according to the standard method, and penicillin or cephalosporin (100 μg / 100ml) was added.
[0122] Select the fresh milk sample to be tested, draw 0.5ml sample, spread it on the pre-prepared antibiotic SDA petri dish in a sterile environment, cultivate it at 37°C for 3 days, and observe the growth of the colony. The results are as follows: Figure 4 shown.
[0123] Image 6 It was shown that wet, shiny, colorless, transparent, round, raised surface and small colonies with neat edges were formed in the petri dish. As a parallel test, 0.5ml of pasteurized fresh milk sample was selected as a control, and no colonies were formed after being cultured on SDA medium for 3 days. Therefore, the colonies in the antibiotic SDA medium were suspected to be Brucella bovis.
[0124] In order to further identify the suspected colony, the fresh milk sa...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 