Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primers and detection kit for avian leukosis J subgroup virus PCR detection

A technology of avian leukemia virus and detection kit, which is applied in the field of molecular biology, can solve the problems of inability to distinguish viruses, not suitable for whole group detection in farms, expensive, etc., and achieves the effects of convenient use, low cost, simple and fast operation

Inactive Publication Date: 2013-02-27
SICHUAN AGRI UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, ELISA kits are often used for the detection of avian leukemia, which has high accuracy, but has two major disadvantages: 1) the price is very expensive, and it is not suitable for the detection of whole groups in farms; 2) ELISA reagents can only detect exogenous avian leukosis virus and cannot distinguish virus subgroups

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and detection kit for avian leukosis J subgroup virus PCR detection
  • Primers and detection kit for avian leukosis J subgroup virus PCR detection
  • Primers and detection kit for avian leukosis J subgroup virus PCR detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] The design of embodiment 1 PCR primer

[0024] The two ends of the RNA genome of avian leukosis virus are non-coding regions, and the middle part is the coding region. There are 4 structural genes in the coding region, which are gag / pro-pol-env from 5' to 3'. The invention designs primers for the special env gene sequence of J subgroup avian leukosis virus. After multiple rounds of screening, the following primers were found to be able to quickly and accurately detect subgroup J avian leukosis virus qualitatively. Through PCR amplification, the individual who can obtain the fragmentation of the env gene sequence means that the individual contains J subgroup avian leukosis virus.

[0025] The nucleotide sequence of the primer that detects J subgroup avian leukosis virus provided by the invention:

[0026] Upstream primer: 5'TTAAACCGGACATCACCCCAAAAGGA 3' (SEQID No.1)

[0027] Downstream primer: 5'AGCACACCGAACCAAAGGTAACACA 3' (SEQ ID No.2).

Embodiment 2

[0028] The extraction of embodiment 2 total DNA

[0029] (1) Extraction of chicken blood DNA. Take 10 μL of citrate-anticoagulated blood sample into a 1.5mL Eppendorf tube, add 400 μL of buffer solution and shake gently; then add 100 μL of 47.765g / 100mL guanidine hydrochloride solution and 20 μl of proteinase K, vortex to mix and place at 56°C Digest in a metal bath for 5 hours; add 600 μL of chloroform, shake and centrifuge at 4°C, 12,000 rpm for 15 minutes, take the supernatant and transfer it to another Eppendorf tube; take the supernatant, add an equal volume of isopropanol, and put it in an ice box for precipitation 2 After 4 hours, centrifuge at 4°C, 15min, 12000rpm, pour the supernatant; add 777μL of absolute ethanol, centrifuge at 4°C, 12000rpm, 15min, discard the supernatant; add 48μL (appropriate amount) of ultrapure water to dissolve the precipitate (and obtain a DNA solution); The total DNA was detected with 0.8% agarose gel, and its concentration and purity were ...

Embodiment 3

[0031] Embodiment 3 Establishment of PCR amplification method

[0032] 1. PCR reaction system

[0033] The mixed total DNA of Example 2 was used as a template, and the primers of Example 1 were used as primers for PCR reaction. The 20 μL reaction system included 10 μL of PCR-Mix (purchased from Tiangen Company), ddH 2 O 7 μL, 1 μL of 10 pmol / μL upstream and downstream primers and 1 μL of chicken total DNA.

[0034] 2. PCR reaction conditions

[0035] The temperature of the primers was optimized using a temperature gradient PCR instrument, and 8 temperature gradients were screened between 52°C and 62°C. The PCR products were detected by 1.5% agarose gel electrophoresis, and the target band was finally selected. The most single, bright 55°C is the best PCR annealing temperature condition when using this kit.

[0036]After putting the PCR tube containing the sample into the PCR machine, set the following conditions for reaction: pre-denaturation at 95°C for 4 minutes; then den...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The present invention provides primers and a detection kit for avian leukosis J subgroup virus PCR detection. According to the present invention, PCR detection primers are designed by analyzing avian leukosis J subgroup virus env gene, wherein nucleotide sequences of the primers are represented by sequence lists SEQ ID No.1 and SEQ ID No.2; and the primers have good specificity, and the detection method has characteristics of rapidness, simpleness, high accuracy and good sensitivity so as to provide an excellent detection method for avian leukosis J subgroup virus identification. The present invention further provides a detection kit for the avian leukosis virus, wherein the detection kit comprises a primer pair represented by the sequence lists SEQ ID No.1-2.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to PCR detection primers and a detection kit for detecting avian leukosis J subgroup virus. Background technique [0002] With the continuous deepening of large-scale breeding in the poultry industry, the threat of poultry diseases has become increasingly prominent. Avian Leukosis (Avian Leukosis, AL) can infect all chickens due to its high infection rate and its ability to spread both horizontally (cross-infection between flocks) and vertically (the disease can be passed on to the next generation). It is one of the main diseases that endanger the poultry industry, and the economic losses caused by poultry diseases are as high as tens of billions of dollars every year in the world. [0003] But so far, humans have almost no way to prevent and treat avian leukemia. There is neither vaccine nor effective medicine to treat it. The main method to control avian leukemia is to eliminate ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
Inventor 朱庆兰茜胡耀东尹华东刘益平王彦李天杰尹月吴杰兰丹
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com