Low temperature beta-agarase and coding gene and application thereof

An agarase and low temperature technology, applied in the field of genetic engineering, can solve the problems of high processing cost and energy consumption, and achieve the effect of low cost and strong low temperature tolerance

Inactive Publication Date: 2013-04-17
THE FIRST INST OF OCEANOGRAPHY SOA
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The above-mentioned β-agarases all need an external heat source to achieve the optimum enzyme activity, so energy is consumed and the processing cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Low temperature beta-agarase and coding gene and application thereof
  • Low temperature beta-agarase and coding gene and application thereof
  • Low temperature beta-agarase and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Construction of Genome Library of Antarctic Strain Producing β-Agarase

[0030] (1) Preparation of target DNA fragments

[0031] The seed liquid of Pseudoalteromonas (Pseudoalteromonas) NJ-21 was inoculated in Zobell 2216E seawater medium, cultured in a shaking incubator at 10°C and 150rpm for 3 days, and then extracted with bacterial genome extraction kit (purchased from Tiangen Company, DP302 -02) Extract chromosomal DNA and detect its electrophoretic DNA concentration. The DNA length is greater than 40kb, which meets the requirements for library construction.

[0032] (2) Partial digestion of genomic DNA

[0033] The chromosomal DNA of Pseudoalteromonas NJ-21 was partially digested with Sau3AI endonuclease, and the insert fragment was obtained after digestion with Sau3AI endonuclease for 60 min. After 60 minutes of enzyme digestion, the chromosomal DNA is just digested completely, which is suitable for the construction of genomic libraries; when the enzyme digestio...

Embodiment 2

[0041] Acquisition of the Complete Sequence of Low Temperature β-Agarase NJ21

[0042] Screen the genomic library for a clone with a distinct ring of hydrolysis surrounding it. The recombinant plasmid was extracted, and the recombinant plasmid was extracted and sequenced to obtain the complete ORF of low-temperature β-agarase NJ21. The complete length of ORF is 2382bp, encoding a total of 794 amino acids, and its theoretical molecular weight is calculated to be 88kDal.

Embodiment 3

[0044] Construction of Recombinant Expression Plasmid and Recombinant Strain of Low Temperature β-Agarase NJ21

[0045] The low-temperature β-agarase gene NJ21 obtained in the present invention is cloned into an expression vector to construct a recombinant expression strain. First, design primers for amplifying the entire gene based on the full-length sequence:

[0046] Upstream primer F-ACGC GTCG ACATGAACGCCAGTAAAAAGCTTTTGT;

[0047] Downstream primer R-CCG CTCGAG TTATTTTGAACCGAAACGACGCTCG;

[0048]PCR amplification confirmed the full-length sequence of the gene. The expression plasmid was constructed by enzyme digestion cloning, that is, the PCR product was double-enzyme-digested with XhoI endonuclease and SalI endonuclease, and the digested fragment was recovered by cutting the gel. The cut plasmid pET22b was ligated and transformed into Escherichia coli TOP10, and positive clones were screened for ampicillin resistance. A plasmid extraction kit (purchased from Tian...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a low temperature beta-agarase and a coding gene and an application thereof. The nucleotide sequence of the low temperature beta-agarase gene NJ21 is shown as SEQ ID NO. 1. The amino acid sequence of the low temperature beta-agarase NJ21 is shown as SEQ ID NO. 2. The invention further relates to the application of the low temperature beta-agarase NJ21 in industrial degradation of agarose. According to the invention, gene of agarase is cloned and obtained from Antarctic bacterial strains which generate agarase and can be cloned to appropriate hosts to realize heterologous expression, and finally industrialized production of agarase is realized. The low temperature beta-agarase NJ21 has stronger low temperature tolerance and provides an initial material of agarase which is low in cost for subsequent industrial application.

Description

technical field [0001] The invention relates to a low-temperature β-agarase and its coding gene and application, belonging to the technical field of genetic engineering. Background technique [0002] Agarase is an important marine biological enzyme, which has a wide range of applications in biochemical, clinical, pharmaceutical, food and other fields. Agar degrading bacteria are widely distributed, but mainly exist in the ocean, less in soil and fresh water, and the marine ecological environment is complex, especially the microorganisms in the polar (South and North) marine environment are due to high salinity, high radiation, low temperature, Repeated freezing and thawing and special light characteristics may cause adaptive changes in the genetic structure and physiological habits of marine microorganisms, and can produce various enzymes with specific physiological activities. Therefore, the agarase isolated from polar marine microorganisms may have unique degradation acti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12P19/14
Inventor李江
OwnerTHE FIRST INST OF OCEANOGRAPHY SOA