Low temperature beta-agarase and coding gene and application thereof
An agarase and low temperature technology, applied in the field of genetic engineering, can solve the problems of high processing cost and energy consumption, and achieve the effect of low cost and strong low temperature tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Construction of Genome Library of Antarctic Strain Producing β-Agarase
[0030] (1) Preparation of target DNA fragments
[0031] The seed liquid of Pseudoalteromonas (Pseudoalteromonas) NJ-21 was inoculated in Zobell 2216E seawater medium, cultured in a shaking incubator at 10°C and 150rpm for 3 days, and then extracted with bacterial genome extraction kit (purchased from Tiangen Company, DP302 -02) Extract chromosomal DNA and detect its electrophoretic DNA concentration. The DNA length is greater than 40kb, which meets the requirements for library construction.
[0032] (2) Partial digestion of genomic DNA
[0033] The chromosomal DNA of Pseudoalteromonas NJ-21 was partially digested with Sau3AI endonuclease, and the insert fragment was obtained after digestion with Sau3AI endonuclease for 60 min. After 60 minutes of enzyme digestion, the chromosomal DNA is just digested completely, which is suitable for the construction of genomic libraries; when the enzyme digestio...
Embodiment 2
[0041] Acquisition of the Complete Sequence of Low Temperature β-Agarase NJ21
[0042] Screen the genomic library for a clone with a distinct ring of hydrolysis surrounding it. The recombinant plasmid was extracted, and the recombinant plasmid was extracted and sequenced to obtain the complete ORF of low-temperature β-agarase NJ21. The complete length of ORF is 2382bp, encoding a total of 794 amino acids, and its theoretical molecular weight is calculated to be 88kDal.
Embodiment 3
[0044] Construction of Recombinant Expression Plasmid and Recombinant Strain of Low Temperature β-Agarase NJ21
[0045] The low-temperature β-agarase gene NJ21 obtained in the present invention is cloned into an expression vector to construct a recombinant expression strain. First, design primers for amplifying the entire gene based on the full-length sequence:
[0046] Upstream primer F-ACGC GTCG ACATGAACGCCAGTAAAAAGCTTTTGT;
[0047] Downstream primer R-CCG CTCGAG TTATTTTGAACCGAAACGACGCTCG;
[0048]PCR amplification confirmed the full-length sequence of the gene. The expression plasmid was constructed by enzyme digestion cloning, that is, the PCR product was double-enzyme-digested with XhoI endonuclease and SalI endonuclease, and the digested fragment was recovered by cutting the gel. The cut plasmid pET22b was ligated and transformed into Escherichia coli TOP10, and positive clones were screened for ampicillin resistance. A plasmid extraction kit (purchased from Tian...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 