ELISA (enzyme-linked immuno sorbent assay) kit for detecting sterigmatocystin
A versicolor kit technology, applied in the field of biochemistry, can solve the problems of high cost, certain requirements for the purity of standard products, expensive instruments, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] The preparation of embodiment 1 anti-aspergillus versicolor antibody
[0037] 1. Materials
[0038] Versicolor standard was purchased from FERMENTEK; helper phage VCSM13, glycine, anti-human Fab secondary antibody, SB medium, ampicillin, tetracycline, kanamycin, PEG8000, XL 1 -Blue fine; All unspecified reagents and materials are commercially available.
[0039] 2. Methods and Results
[0040] 1. Amplification of Phage Library
[0041] Add 50μl XLI-Blue to 50ml SB medium at 250rpm, shake at 37°C for 2h. Add 10 μl of the original phage library, infect at room temperature for 15 minutes, add 25 μl of 100 mg / ml ampicillin, shake at 300 rpm for 2 hours at 37 degrees. Add 148 ml of SB medium containing ampicillin and tetracycline and 2 ml at a titer of 10 12 pfu / ml helper phage VCSM13, shake at 300 rpm at 37°C for 2 hours, then add kanamycin to 70 μg / ml, shake at 300 rpm at 37°C overnight. After centrifugation at 3000g for 15 minutes, the supernatant was precipitated w...
Embodiment 2
[0049] Example 2 Capture of Anti-Varistoxin Antibody Gene and Its Prokaryotic Expression
[0050] 1. Materials
[0051] Promega; DNA polymerase One Taq: New England Biolabs; DNA fragment purification kit: OMEGA Biotechnology Company; T4 DNA ligase: New England Biolabs; competent bacteria JM109: purchased from Promega; pET28a vector. The rest of the reagents or materials are commercially available.
[0052] Antibody variable region gene amplification primers are shown in Table 1, synthesized by Invitorgen,
[0053] Table 1 Antibody variable region gene amplification primers
[0054] pAS: TTGCAAGCTTATGAGGAGACGGTGACCA
pA2S: TGACGAATTCGAAATTGTGTTGACGCAGT
pA8S: CCTCGAATTCCAGTCTGTGCTGACTCAG
pB2S: CGTAGAATTCTCCTCTGAGCTGACTCAGG
[0055] pC11S: CGATGAATTCCAGTCTGTGCTGACGCA
[0056] 2. Methods and Results
[0057] 1. The catching of the anti-aspergillus versicolor antibody gene: Utilize PCR technique, with above-mentioned specific...
Embodiment 3
[0063] Embodiment 3 Preparation of an ELISA detection kit for detecting Aspergillus versicolor
[0064] 1. Materials
[0065] Anti-Aspergillus versicolor ASP1 antibody, horseradish peroxidase (HRP), 4-(N-maleimidomethyl)cyclohexane-1-carboxylate sulfosuccinimidyl ester sodium salt (sulfo-SMCC), Sephadex G25, Phosphate Buffered Saline (PBS), BSA, ST, NaBH 4 .
[0066] 2. Method
[0067] 2.1. Conjugation of anti-aspergillin ASP1 antibody to horseradish peroxidase
[0068] 1) The purified ASP1 antibody was dialyzed to 0.01M PBS to remove all possible substances containing NH3, such as TRIS base, etc., and the pH value was adjusted to about 7 with 3M NaOH.
[0069] 2) According to the instructions of Sulfo-SMCC, dissolve sulfo-SMCC with pure water, the ratio of ASP1 antibody to Sulfo-SMCC = 1:100, slowly add the sulfo-SMCC solution drop by drop into the ASP1 antibody solution under stirring, and stir at room temperature for more than 30 minutes .
[0070] 3) Equilibrate the Se...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 