Check patentability & draft patents in minutes with Patsnap Eureka AI!

ELISA (enzyme-linked immuno sorbent assay) kit for detecting sterigmatocystin

A versicolor kit technology, applied in the field of biochemistry, can solve the problems of high cost, certain requirements for the purity of standard products, expensive instruments, etc.

Inactive Publication Date: 2013-07-10
TAIZHOU ENTRY EXIT INSPECTION & QUARANTINE BUREAU PEOPLES REPUBLIC OF CHINA
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] High-performance liquid chromatography and mass spectrometry detection methods can make accurate qualitative and quantitative determinations, and can even measure the content of each component when used properly. They have high sensitivity and strong selectivity, and have excellent development prospects, but the requirements for sample pretreatment are strict. , there are certain requirements on the purity of standard products, and the instruments are expensive, and the testers often need special training, so the cost is relatively high
Therefore, it is only suitable for large enterprises or units that require high detection sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ELISA (enzyme-linked immuno sorbent assay) kit for detecting sterigmatocystin
  • ELISA (enzyme-linked immuno sorbent assay) kit for detecting sterigmatocystin
  • ELISA (enzyme-linked immuno sorbent assay) kit for detecting sterigmatocystin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The preparation of embodiment 1 anti-aspergillus versicolor antibody

[0037] 1. Materials

[0038] Versicolor standard was purchased from FERMENTEK; helper phage VCSM13, glycine, anti-human Fab secondary antibody, SB medium, ampicillin, tetracycline, kanamycin, PEG8000, XL 1 -Blue fine; All unspecified reagents and materials are commercially available.

[0039] 2. Methods and Results

[0040] 1. Amplification of Phage Library

[0041] Add 50μl XLI-Blue to 50ml SB medium at 250rpm, shake at 37°C for 2h. Add 10 μl of the original phage library, infect at room temperature for 15 minutes, add 25 μl of 100 mg / ml ampicillin, shake at 300 rpm for 2 hours at 37 degrees. Add 148 ml of SB medium containing ampicillin and tetracycline and 2 ml at a titer of 10 12 pfu / ml helper phage VCSM13, shake at 300 rpm at 37°C for 2 hours, then add kanamycin to 70 μg / ml, shake at 300 rpm at 37°C overnight. After centrifugation at 3000g for 15 minutes, the supernatant was precipitated w...

Embodiment 2

[0049] Example 2 Capture of Anti-Varistoxin Antibody Gene and Its Prokaryotic Expression

[0050] 1. Materials

[0051] Promega; DNA polymerase One Taq: New England Biolabs; DNA fragment purification kit: OMEGA Biotechnology Company; T4 DNA ligase: New England Biolabs; competent bacteria JM109: purchased from Promega; pET28a vector. The rest of the reagents or materials are commercially available.

[0052] Antibody variable region gene amplification primers are shown in Table 1, synthesized by Invitorgen,

[0053] Table 1 Antibody variable region gene amplification primers

[0054] pAS: TTGCAAGCTTATGAGGAGACGGTGACCA

pA2S: TGACGAATTCGAAATTGTGTTGACGCAGT

pA8S: CCTCGAATTCCAGTCTGTGCTGACTCAG

pB2S: CGTAGAATTCTCCTCTGAGCTGACTCAGG

[0055] pC11S: CGATGAATTCCAGTCTGTGCTGACGCA

[0056] 2. Methods and Results

[0057] 1. The catching of the anti-aspergillus versicolor antibody gene: Utilize PCR technique, with above-mentioned specific...

Embodiment 3

[0063] Embodiment 3 Preparation of an ELISA detection kit for detecting Aspergillus versicolor

[0064] 1. Materials

[0065] Anti-Aspergillus versicolor ASP1 antibody, horseradish peroxidase (HRP), 4-(N-maleimidomethyl)cyclohexane-1-carboxylate sulfosuccinimidyl ester sodium salt (sulfo-SMCC), Sephadex G25, Phosphate Buffered Saline (PBS), BSA, ST, NaBH 4 .

[0066] 2. Method

[0067] 2.1. Conjugation of anti-aspergillin ASP1 antibody to horseradish peroxidase

[0068] 1) The purified ASP1 antibody was dialyzed to 0.01M PBS to remove all possible substances containing NH3, such as TRIS base, etc., and the pH value was adjusted to about 7 with 3M NaOH.

[0069] 2) According to the instructions of Sulfo-SMCC, dissolve sulfo-SMCC with pure water, the ratio of ASP1 antibody to Sulfo-SMCC = 1:100, slowly add the sulfo-SMCC solution drop by drop into the ASP1 antibody solution under stirring, and stir at room temperature for more than 30 minutes .

[0070] 3) Equilibrate the Se...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an ELISA (enzyme-linked immuno sorbent assay) kit for detecting sterigmatocystin, wherein the kit comprises a sterigmatocystin antibody, the antibody comprises a light chain and a heavy chain, the amino acid sequence of the light chain is shown as the sequence table SEQ ID NO.1; and the amino acid sequence of the heavy chain is shown as the sequence table SEQ ID NO.2. The invention further discloses a method for preparing the antibody. The ELISA kit provided by the invention comprises a horse radish Peroxidase substrate buffer liquid, a protein standard product ST (100 micro g / ml, 0.1ml), dox-ova BSA-ST and negative control sample BSA. The invention also discloses a using method of the kit.

Description

technical field [0001] The present invention relates to the field of biochemistry. Specifically, the present invention relates to an ELISA kit for detecting Aspergillus versicolor. Background technique [0002] Sterigmatocys (ST for short) is a heterocyclic compound (Figure) with strong liver and kidney toxins, and can induce a variety of tumors. The high incidence of liver cancer in some areas of South Africa may be related to ST. Versicolor is mutagenic, can cause cholangiocarcinoma and liver cancer, but the frequency of food contamination is low. ST can also be converted into a more potent carcinogen, aflatoxin. ST can also cause some animal diseases. ST can be metabolized by more than 10 kinds of fungi, and the yield in artificial medium can reach as high as 10g / kg. Foods known to be contaminated by ST include: rice, wheat, corn, peanuts, soybeans, ham, cheese, coffee, etc. Aspergillus versicolor is heated after being sprayed with aluminum trichloride, and it can s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/14C12N15/11G01N33/577
Inventor 江飞剑王海彬杨承刚韦国栋
Owner TAIZHOU ENTRY EXIT INSPECTION & QUARANTINE BUREAU PEOPLES REPUBLIC OF CHINA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More