Fusion protein of RSV (respiratory syncytial virus) protein F and Fc, and application thereof
A fusion protein, syncytial virus technology, applied in antiviral agents, medical preparations with non-active ingredients, medical preparations containing active ingredients, etc. spread and other problems to achieve the effect of enhancing virus infection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1: the gene of cloning RSV F albumen
[0034] Inoculate 2 × 10 cells per well in a 6-well plate 6 HEp-2 cells were cultured for 12-14 hours, and the cells grew into a monolayer. Remove medium, follow 50TCID 50 Inoculate 500ul of virus into the well plate, incubate at 37°C for 1h, then remove the virus solution, add 2ml of fresh MEM medium containing 2% fetal bovine serum (FBS) to each well, and incubate at 37°C for 48h. The total cellular RNA was extracted with Trizol Reagent (Invitrogen Company), and the obtained total cellular RNA was dissolved in 50 ul of RNase-free water. Then use M-MLV Reverse Transcriptase Kit (Promega Company) and use random primers to reverse transcribe to obtain cDNA.
[0035] According to the gene sequence of RSV (GenBank Accession: AY911262.1), design the forward and reverse primers of the F gene: forward primer GG GGTACC ATGGGATCTAAGGTCCTG (horizontal line marked as KpnI restriction site); reverse primer CCG CTCGAG CTAATTTG...
Embodiment 2
[0037] Example 2. Cloning of human antibody IgG1 constant region Fc gene
[0038] B cells were isolated from fresh plasma, total cellular RNA was extracted with Trizol Reagent (Invitrogen), and the obtained total cellular RNA was dissolved in 50 ul of RNase-free water. Then use the M-MLV Reverse Transcriptase Kit (Promega Company) with oligo(dT) as a primer to reverse transcribe to obtain cDNA.
[0039] Forward and reverse primers of the Fc gene were designed: forward primer GAGCCCAAATCTTGTGACAAAACTC; reverse primer TTTACCCGGAGACAGGGAGAGGC. Using cDNA as a template, the Fc gene fragment was amplified by PCR with KOD DNA polymerase (MBI Company).
[0040] The Fc gene fragment was recovered by agarose gel electrophoresis, connected to the pGEM-T-easy vector (Promega Company) to construct the vector pGEM-T-easy-Fc, and the sequence of the vector was confirmed to be correct.
Embodiment 3
[0041] Embodiment 3. Construction of the fusion gene of RSV F gene and human antibody IgG1 constant region Fc gene
[0042] Primers were designed, and PCR was used to connect the RSV F gene and the Fc gene of the constant region of human antibody IgG1 to construct an F-Fc fusion form. The specific method is as follows:
[0043] First, use the F gene as a template and use the forward primer: GG GGTACC ATGGGATCTAAGGTCCTG (marked as the KpnI restriction site) and reverse primer: CCGCCTCCACCATTTGTGGTTGAT for PCR amplification, extending a sequence overlapping with the Fc gene at the 3' end of the F gene; at the same time, using the Fc gene as a template, use the forward primer : GGAGGTGGCTCTGGCGGTGGCGGATCAGAGCCCAAATC and reverse primer: CCG CTCGAG TCATTTACCCGGAGACAG (the horizontal line marks the XhoI restriction site) was amplified by PCR, and a sequence overlapping with the F gene was extended at the 5' end of the Fc gene; the gene fragment obtained by PCR was recovered, and...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap