Method for producing ligninolytic enzymes
A technology of lignin and laccase, applied in the biological field, can solve the problems of high production cost, slow growth and high nutritional requirements, and achieve the effect of saving raw materials
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0018] 1.1 Construction of cloning vector
[0019] The two base complementary double strands of the E. coli replication origin are synthesized by a professional DNA sequence synthesis formula, and sticky ends are formed at both ends of each DNA strand sequence. It is circularized by the action of T4 DNA ligase to form a DNA cloning vector. Name this cloning vector PM.
[0020] 1.2 Obtain the DNA sequence of the target gene and construct the relevant elements of the expression vector
[0021] 1.2.1 Amplification of lignin peroxidase gene and manganese peroxidase gene of white rot fungi by reverse transcription PCR
[0022] Synthesize the following PCR primers:
[0023] Primer 1.5'TC GAATTC GCCACCTGTTCCAACGGCAAGACCGTCGGC3'[Description: The 8 bases at the 5' end of the primer are enzyme-cleaved protection bases (2 bases) and DNA restriction endonuclease recognition sites (6 bases underlined)]
[0024] Primer 2.5'CA GCGGCCGC CTAAGCACCCGGAGGCGGAGGGATGCGCTG 3'[Description: Th...
Embodiment 2
[0067] 2.1 Construction of cloning vector
[0068] The two base complementary double strands of the E. coli replication origin are synthesized by a professional DNA sequence synthesis formula, and sticky ends are formed at both ends of each DNA strand sequence. It is circularized by the action of T4 DNA ligase to form a DNA cloning vector. Name this cloning vector NM.
[0069] 2.2 Obtain the DNA sequence of the target gene and construct the relevant elements of the expression vector
[0070] 2.2.1 Use reverse transcription PCR to amplify the lignin peroxidase gene and manganese peroxidase gene of white rot fungi to synthesize the following PCR primers:
[0071] Primer 1.5'TC GAATTC GCCACCTGTTCCAACGGCAAGACCGTCGGC3'[Description: The 8 bases at the 5' end of the primer are enzyme-cleaved protection bases (2 bases) and DNA restriction endonuclease recognition sites (6 bases underlined)]
[0072] Primer 2.5'CA GCGGCCGC CTAAGCACCCGGAGGCGGAGGGATGCGCTG 3'[Description: The 10 bas...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap