Method for producing ligninolytic enzymes

A technology of lignin and laccase, applied in the biological field, can solve the problems of high production cost, slow growth and high nutritional requirements, and achieve the effect of saving raw materials

Inactive Publication Date: 2013-07-17
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the slow growth of natural enzyme-producing strains or (and) high nutritional requirements, the production cost is higher
Currently, there are studies using engineering bacteria to produce these three enzymes separately. Since one strain is used to produce one of the enzymes, three processes are required to produce the three enzymes, which makes the production cost too high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] 1.1 Construction of cloning vector

[0019] The two base complementary double strands of the E. coli replication origin are synthesized by a professional DNA sequence synthesis formula, and sticky ends are formed at both ends of each DNA strand sequence. It is circularized by the action of T4 DNA ligase to form a DNA cloning vector. Name this cloning vector PM.

[0020] 1.2 Obtain the DNA sequence of the target gene and construct the relevant elements of the expression vector

[0021] 1.2.1 Amplification of lignin peroxidase gene and manganese peroxidase gene of white rot fungi by reverse transcription PCR

[0022] Synthesize the following PCR primers:

[0023] Primer 1.5'TC GAATTC GCCACCTGTTCCAACGGCAAGACCGTCGGC3'[Description: The 8 bases at the 5' end of the primer are enzyme-cleaved protection bases (2 bases) and DNA restriction endonuclease recognition sites (6 bases underlined)]

[0024] Primer 2.5'CA GCGGCCGC CTAAGCACCCGGAGGCGGAGGGATGCGCTG 3'[Description: Th...

Embodiment 2

[0067] 2.1 Construction of cloning vector

[0068] The two base complementary double strands of the E. coli replication origin are synthesized by a professional DNA sequence synthesis formula, and sticky ends are formed at both ends of each DNA strand sequence. It is circularized by the action of T4 DNA ligase to form a DNA cloning vector. Name this cloning vector NM.

[0069] 2.2 Obtain the DNA sequence of the target gene and construct the relevant elements of the expression vector

[0070] 2.2.1 Use reverse transcription PCR to amplify the lignin peroxidase gene and manganese peroxidase gene of white rot fungi to synthesize the following PCR primers:

[0071] Primer 1.5'TC GAATTC GCCACCTGTTCCAACGGCAAGACCGTCGGC3'[Description: The 8 bases at the 5' end of the primer are enzyme-cleaved protection bases (2 bases) and DNA restriction endonuclease recognition sites (6 bases underlined)]

[0072] Primer 2.5'CA GCGGCCGC CTAAGCACCCGGAGGCGGAGGGATGCGCTG 3'[Description: The 10 bas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing ligninolytic enzymes, and belongs to the biotechnical field. The method comprises the following steps: 1, respectively cloning lignin peroxidase, manganese peroxidase and laccase genes from microbes; 2, constructing a Pichia pastoris expression vector containing the expression cassettes of the above three genes, and a Saccharomyces cerevisiae expression vector containing the expression cassettes, and converting the above vectors to corresponding host bacteria to obtain engineering bacteria; and 3, respectively fermenting Pichia pastoris expression engineering bacteria and Saccharomyces cerevisiae engineering bacteria to produce recombinant lignin peroxidase, manganese peroxidase and laccase. The method has the following advantages: engineering bacteria are used to substitute natural bacterial strains to produce the lignin peroxidase, manganese peroxidase and laccase, so the enzyme outputs are improved through increasing the copy numbers of the genes; and the engineering bacteria containing three enzyme gene expression cassettes substitute engineering bacteria containing a single enzyme gene expression cassette to produce single enzymes, so the raw material, the energy consumption and the manpower resource are saved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for constructing microbial engineering bacteria to produce recombinant proteins. Specifically, the method uses microbial engineering bacteria to produce recombinant mixed lignin peroxidase, manganese peroxidase and laccase. Background technique [0002] Lignin Peroxidase (LiP), Manganese Peroxidase (MnP) and Laccase have the function of degrading lignin together. [0003] Plant resources are constantly regenerated and are very rich. The basic components of plants are cellulose, hemicellulose and lignin. Among them, the most useful component in the manufacture of biogas and ethanol industry is cellulose, followed by hemicellulose. The basic component of the former is glucose, while the basic component of the latter is pentose. These sugars are converted into ethanol and biogas. Lignin is an amorphous, aromatic polymer containing oxyphenylpropanol or its derivatives in its ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/08C12N9/02C12N15/81C12R1/84C12R1/865
Inventor张爱联符仙杨穗珊尹慧祥张添元罗进贤
OwnerINST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI