Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Brucella abortus indirect enzyme linked immunosorbent assay (ELISA) detection kit

A technology of Brucella bovis and detection kit, which is applied in the fields of biotechnology and veterinary medicine, can solve problems such as short existence time, and achieve the effects of less time-consuming, good sensitivity and simple pretreatment process.

Inactive Publication Date: 2013-10-09
DAIRY CATTLE RES CENT SHANDONG ACADEMY OF AGRI SCI
View PDF5 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there is a competitive enzyme-linked immunosorbent assay kit (Chinese invention patent application with publication number CN101592661A) established for smooth Brucella lipopolysaccharide, this method is based on lipopolysaccharide, and the existence time of antibodies is relatively long after they are produced. Short, and competitive ELISA can only make a qualitative judgment on the infection of Brucella in diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brucella abortus indirect enzyme linked immunosorbent assay (ELISA) detection kit
  • Brucella abortus indirect enzyme linked immunosorbent assay (ELISA) detection kit
  • Brucella abortus indirect enzyme linked immunosorbent assay (ELISA) detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Materials and methods

[0040] Strains and plasmids: Brucella bovis S2 attenuated vaccine was provided by China Veterinary Drug Administration, pET32a(+) expression vector plasmid was preserved by the Laboratory of Dairy Cow Research Center, Shandong Academy of Agricultural Sciences, PEASY-T3 Cloning Vector and Trans5a, DH5a, BL21 (DE3) Competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0041] Reagents: rTaq enzyme, T4DNA ligase, dNTP, DL2000Marker and restriction endonucleases BamHI, HindIII, IPTG, X-Gal were purchased from Dalian Bao Biological Products Co., Ltd.; Gel / PCR extraction Kit and plasma Miniprep Kit were purchased from BIOMIGA Company; Protein loading buffer and low molecular weight protein markers were purchased from Fermentas; Ni-NTA Spin Kit was purchased from QIAGEN.

Embodiment 2

[0043] PCR Amplification and Sequencing of Brucella Virb8 Gene

[0044] The gene of Brucella Virb8 (GenBank: AF226278.1) was found in GenBank, and a pair of specific primers were designed using Primer5 as follows:

[0045] Upstream primer 5'—GGATCCATGTTTGGACGCAAACAATCTCC—3';

[0046] Downstream primer 5'—AAGCTTTCATTGCACCACTCCCATTTCTGG—3', as shown in sequences 1 and 2 in the sequence listing;

[0047] A BamHI restriction site was introduced upstream, a HindIII restriction site was introduced downstream, and the primers were synthesized by BGI.

[0048] Genomic DNA of attenuated Brucella bovis vaccine strain S2 was extracted by boiling method, and Virb8 gene was amplified using it as a template. Reaction program: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 1 min; a total of 35 cycles; final extension at 72°C for 2 min. After amplification, 5 μl of the PCR product was taken and detected by electrophoresi...

Embodiment 3

[0051] Construction and Identification of Recombinant Expression Plasmid pET-32a / Virb8

[0052] The correct recombinant plasmid PEASY-T3 / Virb8 and the vector pET-32a(+) were double-digested and sequenced with the restriction endonuclease BamH I enzyme and Hind III enzyme, and the purified Virb8 and linearized pET32a were recovered respectively ( +) Gene fragments. After ligation with T4 DNA ligase for 16 hours at 16°C, it was transformed into competent cells DH5α, and the recombinant plasmid pET-32a / Virb8 was constructed. After expanding the culture, the plasmid was extracted and identified by enzyme digestion. The results are shown in figure 2 . The experimental results show that the target fragment has been inserted into the plasmid and there is no mutation at the restriction site. The extracted plasmid is a positive plasmid and can be further used for the expression of recombinant protein.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a brucella abortus indirect enzyme linked immunosorbent assay (ELISA) detection kit which consists of the following reagents: (1) a pre-enveloped ELISA reaction plate comprising enveloping liquid, an enveloping antigen and closing liquid, (2) plumbous stearate (PBST) washing liquid, (3) IgG-HRP, (4) ending liquid, and (5) color developing liquid, wherein the enveloping antigen is a Virb8 protein. The Virb8 protein related by the invention can be only specifically expressed in the early stage of the brucella abortus infection; an antibody correspondingly produced by the protein is in the early stage of the infection; the produced antibody can live for a long time, so that whether an antibody titer caused by the brucella abortus infection and the quantitative infection exists can be specifically and sensitively judged by cloning and expressing the brucella abortus Virb8 protein and constructing a corresponding indirect ELISA detection method; a quick and accurate method can be supplied to early serologic diagnosis of the brucella abortus disease; the brucella abortus indirect ELISA detection kit has a great practical significance for a brucella abortus site detection technology for a large batch of samples.

Description

technical field [0001] The invention relates to an indirect ELISA detection kit for Brucella bovis, belonging to the fields of biotechnology and veterinary medicine. Background technique [0002] Brucellosis (Brucellosis) is a zoonotic infectious disease caused by Brucella (Brucella). damage. Related studies have shown that the virulence gene Virb8 protein of Brucella is an early specific protein of Brucella infection, which is located outside the Brucella cell membrane and can cause the body's early humoral immune response. [0003] In the actual operation of brucellosis detection, the traditional tiger bengal plate agglutination test and test tube agglutination test have strict requirements for operation and low sensitivity, while the ELISA method has fast qualitative and quantitative characteristics, high sensitivity, wide application range, and objective judgment of results. It has the advantages of low cost and the detection of thousands of samples at the same time. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68G01N33/569G01N33/543
Inventor 杨宏军张亮丁家波孙涛张剑何洪彬
Owner DAIRY CATTLE RES CENT SHANDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com