Brucella abortus indirect enzyme linked immunosorbent assay (ELISA) detection kit
A technology of Brucella bovis and detection kit, which is applied in the fields of biotechnology and veterinary medicine, can solve problems such as short existence time, and achieve the effects of less time-consuming, good sensitivity and simple pretreatment process.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Materials and methods
[0040] Strains and plasmids: Brucella bovis S2 attenuated vaccine was provided by China Veterinary Drug Administration, pET32a(+) expression vector plasmid was preserved by the Laboratory of Dairy Cow Research Center, Shandong Academy of Agricultural Sciences, PEASY-T3 Cloning Vector and Trans5a, DH5a, BL21 (DE3) Competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.
[0041] Reagents: rTaq enzyme, T4DNA ligase, dNTP, DL2000Marker and restriction endonucleases BamHI, HindIII, IPTG, X-Gal were purchased from Dalian Bao Biological Products Co., Ltd.; Gel / PCR extraction Kit and plasma Miniprep Kit were purchased from BIOMIGA Company; Protein loading buffer and low molecular weight protein markers were purchased from Fermentas; Ni-NTA Spin Kit was purchased from QIAGEN.
Embodiment 2
[0043] PCR Amplification and Sequencing of Brucella Virb8 Gene
[0044] The gene of Brucella Virb8 (GenBank: AF226278.1) was found in GenBank, and a pair of specific primers were designed using Primer5 as follows:
[0045] Upstream primer 5'—GGATCCATGTTTGGACGCAAACAATCTCC—3';
[0046] Downstream primer 5'—AAGCTTTCATTGCACCACTCCCATTTCTGG—3', as shown in sequences 1 and 2 in the sequence listing;
[0047] A BamHI restriction site was introduced upstream, a HindIII restriction site was introduced downstream, and the primers were synthesized by BGI.
[0048] Genomic DNA of attenuated Brucella bovis vaccine strain S2 was extracted by boiling method, and Virb8 gene was amplified using it as a template. Reaction program: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 1 min; a total of 35 cycles; final extension at 72°C for 2 min. After amplification, 5 μl of the PCR product was taken and detected by electrophoresi...
Embodiment 3
[0051] Construction and Identification of Recombinant Expression Plasmid pET-32a / Virb8
[0052] The correct recombinant plasmid PEASY-T3 / Virb8 and the vector pET-32a(+) were double-digested and sequenced with the restriction endonuclease BamH I enzyme and Hind III enzyme, and the purified Virb8 and linearized pET32a were recovered respectively ( +) Gene fragments. After ligation with T4 DNA ligase for 16 hours at 16°C, it was transformed into competent cells DH5α, and the recombinant plasmid pET-32a / Virb8 was constructed. After expanding the culture, the plasmid was extracted and identified by enzyme digestion. The results are shown in figure 2 . The experimental results show that the target fragment has been inserted into the plasmid and there is no mutation at the restriction site. The extracted plasmid is a positive plasmid and can be further used for the expression of recombinant protein.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com